Glyma03g30460 - SoyBase

SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g30460

Feature Type:	gene_model
Chromosome:	Gm03
Start:	38417462
stop:	38420087
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma03g30460

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G63010	AT	Annotation by Michelle Graham. TAIR10: alpha/beta-Hydrolases superfamily protein \| chr3:23289717-23290998 FORWARD LENGTH=358	SoyBase	E_val: 0	ISS
GO:0000165	GO-bp	Annotation by Michelle Graham. GO Biological Process: MAPK cascade	SoyBase	N/A	ISS
GO:0000303	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to superoxide	SoyBase	N/A	ISS
GO:0006612	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane	SoyBase	N/A	ISS
GO:0007154	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell communication	SoyBase	N/A	ISS
GO:0007165	GO-bp	Annotation by Michelle Graham. GO Biological Process: signal transduction	SoyBase	N/A	ISS
GO:0008152	GO-bp	Annotation by Michelle Graham. GO Biological Process: metabolic process	SoyBase	N/A	ISS
GO:0008219	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell death	SoyBase	N/A	ISS
GO:0009409	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cold	SoyBase	N/A	ISS
GO:0009414	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to water deprivation	SoyBase	N/A	ISS
GO:0009723	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus	SoyBase	N/A	ISS
GO:0009733	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus	SoyBase	N/A	ISS
GO:0009737	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus	SoyBase	N/A	ISS
GO:0009738	GO-bp	Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009739	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to gibberellin stimulus	SoyBase	N/A	ISS
GO:0009740	GO-bp	Annotation by Michelle Graham. GO Biological Process: gibberellic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009753	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus	SoyBase	N/A	ISS
GO:0009755	GO-bp	Annotation by Michelle Graham. GO Biological Process: hormone-mediated signaling pathway	SoyBase	N/A	ISS
GO:0009845	GO-bp	Annotation by Michelle Graham. GO Biological Process: seed germination	SoyBase	N/A	ISS
GO:0009862	GO-bp	Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009863	GO-bp	Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009867	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009873	GO-bp	Annotation by Michelle Graham. GO Biological Process: ethylene mediated signaling pathway	SoyBase	N/A	ISS
GO:0009939	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of gibberellic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0010162	GO-bp	Annotation by Michelle Graham. GO Biological Process: seed dormancy process	SoyBase	N/A	ISS
GO:0010325	GO-bp	Annotation by Michelle Graham. GO Biological Process: raffinose family oligosaccharide biosynthetic process	SoyBase	N/A	ISS
GO:0010363	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response	SoyBase	N/A	ISS
GO:0010476	GO-bp	Annotation by Michelle Graham. GO Biological Process: gibberellin mediated signaling pathway	SoyBase	N/A	ISS
GO:0030968	GO-bp	Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response	SoyBase	N/A	ISS
GO:0031348	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response	SoyBase	N/A	ISS
GO:0042538	GO-bp	Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response	SoyBase	N/A	ISS
GO:0043069	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death	SoyBase	N/A	ISS
GO:0048444	GO-bp	Annotation by Michelle Graham. GO Biological Process: floral organ morphogenesis	SoyBase	N/A	ISS
GO:0050832	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to fungus	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0016787	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hydrolase activity	SoyBase	N/A	ISS
KOG1515	KOG	Arylacetamide deacetylase	JGI		ISS
PTHR23024	Panther	MEMBER OF 'GDXG' FAMILY OF LIPOLYTIC ENZYMES	JGI		ISS
PTHR23024:SF10	Panther	CARBOXYLESTERASE-RELATED	JGI		ISS
PF07859	PFAM	alpha/beta hydrolase fold	JGI		ISS
UniRef100_G7I2T6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Gibberellic acid receptor-b n=1 Tax=Medicago truncatula RepID=G7I2T6_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_I1JNP5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JNP5_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma03g30460

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g30460

Paralog	Evidence	Comments
Glyma19g33381	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g30460 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.03g148300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma03g30460

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma03g30460

Limit To All Plant Sequences

>Glyma03g30460.1   sequence type=CDS   gene model=Glyma03g30460   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGGCAGCAACCAAGTCAATCTCAATGAATCTAGGAGTGTTGTTCCTTTAAATACATGGGTGCTTATCTCCAATTTCAAGTTGTCTTACAAGCTTCTCAGACGTGACGATGGAACGTTCAATCGTGAGTTGGCGGAGTATCTCGATAGGAAGGTCCCCGCAAACGCAATTCCCGTTGAAGGTGTGTTTTCAATCGATCACGTTGATAGAAACGCGGGTTTATTCTACCGTGTGTACTTACCAACCTCAGGAAACGAGGCTCAATGGGGTATCAGAGACCTTGAGAAGCCGTTAAGTACTACAGAAATTGTTCCTGTAATCGTATTCTTTCACGGGGGAAGCTTCTCGCATTCCTCGGCCAACAGTCACATCTACGACACCTTCTGCCGCCGCCTTGTGAGGATTTGCAAGGCTGCTGTGGTGTCTGTGAACTACCGGCGGTCACCGGAGCATCGGTATCCTTGTGCATACGACGACGGCTGGGCGGCATTGCGGTGGGTGAAGTCGAGAGCATGGCTGCAAAGTGGGAGGGAGGCCAAGGTTCATGTCTACTTGGCAGGGGACAGTTCTGGAGGGAACATTGTTCATCATGTGGCAGTGAGGGCTGCAGAGGAGGAAATTGAGGTCCTGGGGAATATTCTTCTCCACCCTTTGTTTGGTGGGGAGAAGAGAACGGAATCAGAATTGAGATTGGATGGGAAATACTTTGTGAGGCTTAAGGATCGTGATTGGTATTGGAGAGCTTTTCTACCTGAAGGAGAGAATAGAGACCACCCTGCTTGCAACCCTTTTGGACCAAGGGGGAGAAGCATTGAAGGACTCAAATTCCCTAAAAGTCTTGTTTGTGTGGCTGGTTTGGATCTTCTGCAGGATTGGCAATTGGCATATGCAAAAGGTCTTGAGGATTGTGGACAACAGGTCAAGCTTCTTTTTCTCAAGGAAGCCACTATTGGCTTCTACTTCTTGCCAAACAATGACCATTTCTATTGCCTCATGAAAGAAATCAACAACTTTGTCAATTCTGATTCTGACTGTTAA

Predicted protein sequences of Glyma03g30460

Limit To All Plant Sequences

>Glyma03g30460.1   sequence type=predicted peptide   gene model=Glyma03g30460   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAGSNQVNLNESRSVVPLNTWVLISNFKLSYKLLRRDDGTFNRELAEYLDRKVPANAIPVEGVFSIDHVDRNAGLFYRVYLPTSGNEAQWGIRDLEKPLSTTEIVPVIVFFHGGSFSHSSANSHIYDTFCRRLVRICKAAVVSVNYRRSPEHRYPCAYDDGWAALRWVKSRAWLQSGREAKVHVYLAGDSSGGNIVHHVAVRAAEEEIEVLGNILLHPLFGGEKRTESELRLDGKYFVRLKDRDWYWRAFLPEGENRDHPACNPFGPRGRSIEGLKFPKSLVCVAGLDLLQDWQLAYAKGLEDCGQQVKLLFLKEATIGFYFLPNNDHFYCLMKEINNFVNSDSDC*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain