SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma03g30340

Feature Type:gene_model
Chromosome:Gm03
Start:38312493
stop:38313795
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma03g30340
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G41940AT Annotation by Michelle Graham. TAIR10: zinc finger protein 8 | chr2:17507556-17508329 FORWARD LENGTH=257 SoyBaseE_val: 3.00E-44ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010026GO-bp Annotation by Michelle Graham. GO Biological Process: trichome differentiation SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0016226GO-bp Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
PTHR11389Panther ZINC FINGER PROTEIN JGI ISS
PTHR11389:SF374Panther KRAB-RELATED JGI ISS
UniRef100_B9SYV7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Nucleic acid binding protein, putative n=1 Tax=Ricinus communis RepID=B9SYV7_RICCO SoyBaseE_val: 5.00E-83ISS
UniRef100_I1JNN4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1JNN4_SOYBN SoyBaseE_val: 4.00E-171ISS

Expression Patterns of Glyma03g30340
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma03g30340
ParalogEvidenceComments
Glyma19g33260 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma03g30340 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.03g147200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma03g30340
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma03g30340
>Glyma03g30340.2   sequence type=CDS   gene model=Glyma03g30340   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGACAACACTGAGAAAGAGACCCACGACTTCATGAACGTCGATTCTTTCTCCCAGCTCCCCTTCCTCCGCCCCGCACCACCCTCCAAAGACAAAGCCGCCATTCGCCTCTTCGGCCATGAATTCGGCGACGCGCACCACTCTAACCCTACCCACAACTCATTTATTATCTCCAACAACAACGTTAGCGCCTCCGAACATACCACCAACAAAGACGTCAACAACAACGTAGAAAACGGCGAGAGCAGCCGCAGATTCGAGTGCCATTATTGTTGCAGAAACTTCCCCACTTCCCAGGCCTTAGGCGGGCACCAAAACGCGCACAAACGAGAGCGCCAGCACGCGAAACGACACCTTCAAAGTACCCTGATCTCCGATGCAAACGCGTATAGCTTCATGAACTACAGGTTCGGTTCCACGGCAATGTCTAATTACTCTTACTCTTCTTATCCAACGTGGAACAGTTCCAACTCGTCAAGCGCTATGCTTGGGAACACTGGTGGAACTGGAAGGTTCTACGGAAACTCCTATTCTCAGCAACTTCAAACTATCAATGGAAGCCCTTTGGGTTTGTGGCGAATCCCCACCGCCACTAATAGTACTCATTCCCAAAGTAACCCTATTTTCAACCGCGAACGCTCGTTGCAACCTTTGCCTTTGTTTTCTGGCGAGGAAATGGTGAACGCGAGGATCGGGCACTCTGGTTCGCAGAACCGGTTTGGTAATTATGGTTCCAAGCCCAGCGTAAACGACCATGTGAGTTTGGATCTTCATCTGTAA
Predicted protein sequences of Glyma03g30340
>Glyma03g30340.2   sequence type=predicted peptide   gene model=Glyma03g30340   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDNTEKETHDFMNVDSFSQLPFLRPAPPSKDKAAIRLFGHEFGDAHHSNPTHNSFIISNNNVSASEHTTNKDVNNNVENGESSRRFECHYCCRNFPTSQALGGHQNAHKRERQHAKRHLQSTLISDANAYSFMNYRFGSTAMSNYSYSSYPTWNSSNSSSAMLGNTGGTGRFYGNSYSQQLQTINGSPLGLWRIPTATNSTHSQSNPIFNRERSLQPLPLFSGEEMVNARIGHSGSQNRFGNYGSKPSVNDHVSLDLHL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo