SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma.10g063500

Feature Type:gene_model
Chromosome:Gm10
Start:6003921
stop:6006192
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Annotations for Glyma.10g063500
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G03560.1AT Tetratricopeptide repeat (TPR)-like superfamily protein JGI N/AIEA
GO:0000301GO-bp retrograde transport, vesicle recycling within Golgi EnsemblGenomesN/AIEA
GO:0006890GO-bp retrograde vesicle-mediated transport, Golgi to ER EnsemblGenomesN/AIEA
GO:0007030GO-bp Golgi organization EnsemblGenomesN/AIEA
GO:0048213GO-bp Golgi vesicle prefusion complex stabilization EnsemblGenomesN/AIEA
GO:0017119GO-cc Golgi transport complex EnsemblGenomesN/AIEA
PF09350PFAM Domain of unknown function (DUF1992) JGI N/AIEA

Expression Patterns of Glyma.10g063500
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Related Legume Genes

View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at GlycineMine

Gene information in GlycineMine developed by LIS.


Related Plant Genes

View a gene family containing related genes from other plant species at PhyloGenes

Gene families from PhyloGenes.


Paralogs of Glyma.10g063500
ParalogEvidenceComments
Glyma.13g148000 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Gene model name correspondences to Glyma.10g063500 Gene Call Version Wm82.a2.v1
Corresponding NameAnnotation VersionEvidenceComments
Glyma10g07260 Wm82.a1.v1.1IGC As supplied by JGI


Coding sequences of Glyma.10g063500
>Glyma.10g063500.1 sequence-type=CDS polypeptide=Glyma.10g063500.1.p locus=Glyma.10g063500 ID=Glyma.10g063500.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGGCGACGTGTCTTCGCCTTGGGAGATTTACGACTATTGATTCGCTCTCTCTCTTCGTTTCCACCGCTAGATTCTCCTTTTCTTCATCATCTTCGTCGTCGTCCTCGTCGTCATCTTCCGGTAAGTCCAAGACGGGGAAGAAGCTGATGGATCGTCTTTCCACCGTTATCGACGCCGTCAATGATCGCAAACTACCTCCTGAGCTACGTGGCCAGCGCAGCAATGTCAGGTCAGAAACTGACATTATCAACGTTGTTGAGCAAAGAATATGGCATACCATGGAAGAAGGGAAGTTTGAGAATTTGCCAGGCAAAGGCAAGCCGCTTAAGCTCGACACAAATCCTCATGCAGATCCAGCTGAAGACACCCTGTACCGTATCCTGTCAAAAAACGGATATGCACCGGAGTGGGTTGAACTTAACAAAGAGATTAGATCTAAAATATCTGAATGGAGGAAGTCCTTGAAGAAAGCTTGGGCTACTAAGTGCAGTGGAGATCACTCTGAGTGGGTTGAAAGTTCAGAGGCTTTGAAATCTCAGTTACGAGAAATCAATGATAAGGTTTTCCGTTATAACCTTATTGTGCCTTTTGGTCGGCAAATGTTTGGCCTTAAGTGGGAGAAAGAGCTAGGTTACTTAGAAGAAAAATGA
Predicted protein sequences of Glyma.10g063500
>Glyma.10g063500.1.p sequence-type=predicted peptide transcript=Glyma.10g063500.1 locus=Glyma.10g063500 ID=Glyma.10g063500.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MATCLRLGRFTTIDSLSLFVSTARFSFSSSSSSSSSSSSSGKSKTGKKLMDRLSTVIDAVNDRKLPPELRGQRSNVRSETDIINVVEQRIWHTMEEGKFENLPGKGKPLKLDTNPHADPAEDTLYRILSKNGYAPEWVELNKEIRSKISEWRKSLKKAWATKCSGDHSEWVESSEALKSQLREINDKVFRYNLIVPFGRQMFGLKWEKELGYLEEK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo