SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   DHH_uuu_Gm9-4
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   II
Subclass   II
Order   Helitron
Super Family   Helitron
Family   Ukn
Description  
Chromosome   Gm09
Start Position   25228203
End Position   25242642
Sequence   TCATCTATCATGATACAAACAAGGCCCTGACAATGCTGACTTGGCATTGGCAGGGCTAACGTTTCACTATATACTTATTA
TTTTTGTCGTTTTGTGCGTGGACGGTTCAGTTACCAATGTGTTTTTGATTTTTTCACGCTTTCCATTGTTTCATGCTTTC
CATTGCTACACAGTCTCCATTGTTTGCCGCTTTCCATTTTTCCATTTTCCATTTCCATTGTGCCTTTTCAATTGTGGCTT
TTGAATTGTCTCCCATTTGGATTTGCTCTCCACGCTTTTCATTTTTTGTTGGACTCACCGTAGGTGCACTTTCTTCCTCA
TTTTTGTTTTTCGTTTTCAGCTTGGTTTGGCATGTATGATGAGTTTTGAATATCAACGTTGTCCCTTATTTGCTGTTATG
AATGGTTTGGCTTGGTTTGGTATGTTTGGTTTTTTCATATCTATATCGATGTATGCGTTTTTGTTATGGTATATGACTTT
TCGCAGGCCAACAAGACAAAAGCTTGGACCTTTGTTGATTTTATCATTAGTTTATCTTTTCCTATACGAAGCTTTTCGAT
TTTTCGTGGGTCATTTTTTGATTGGTTTCACATGTTTGGCATGTTTGATTTTTGAATCAGTTGCGAAAAGAATCAGTTTA
TTATCATTTTCTATCCCCAACTGTCTTGCCTTTTGATCTTGCATGTGTATCATTTAGTTTGTTTTTTTGGTGTTCTGATT
TATCGGAAGACAGAATGTTATTTTTGTCTGTGAACCATTTTTGATGATGCTTGTCCATCCTTTATAAGCTTTTTTTGGTT
ATGTAATTTATTGCAACACAAACTTTGTATGGATGTCCATGTTTGCCATTATTCACATGTCTATCAGTGGATACATTTTT
GTTTTATTTTTGAGTTTTTGCAGGACAACAAAACAAAAGCTTAGACCTTTGGGCATTTTATCATTATGTTATCGTTTCTA
AACCCAGATTTGTTGCCTTTTGATCTTCATTTTTGTTTGGCTTGGTTTGGTATGTTTGGTTTTTTCAGATCTATATCGGT
GTATGCGTTTTTGTTATGGTATATGACTTTTCGCAGGCCAAGAAGACAAAAGCTTGGACCTTTGTTGATCTTGAATGTGC
ATCTTTTAGTACTTTTTTTTGGTGTTGTCATTTATTTTGTCAACCCTCTTTTATTTTTTCAATCCTCTTTAATTTGGTTT
CCTATTGGCCAAGAATAACCAAGAAGCCGAAGACTATACCTACTGGTTTGTTCTTCAATTGTCTTATATTTTCTTAAGAA
CTGTGTATAATGTGTTTGACATAAATTTATTTGTAGTCATGTCTCACAAAGAAAACCTCATATGTGAACTGCATACAAAG
AAAGGTACTTGGAAGATAGCGGTGCGAATCACTGATATGTGGCGTCTTAACAAGCAGAATGGTCGACAATCCATTGAGAT
GGTGTTGATGGACCATACGATAATTTAAATGTTCTTCAGTTTAACAAGTTTTTGTACTTTAGTTAACTGACAAGTCTCAT
TTTTATTTGTTGCAGGGTACAAAGATTGGCGCAACTCTATGGCAAGAATTGTTCCTTGAATTTGAGCCCAAGCTGCGTTG
TGGTGGTGCATATGTTATTCAGAACATCAAGGTTGTTGATACTCATTCTGACTACAAAGTGAGTACAATTAAATATTTGG
TTTATTTCGTGAAGACAACGTCTGTCAAAGAGGTAGACAGACCTGAGATTCCTCCCAATGTTCATGCCATTACTGCATTT
GCTGATATAATTTTAGGCGTTGCAAAACCTGATACTTTGGTTGGTATGGAATTTATCCTTTTGGTATGCACCATTGTATG
TAAATTATAAATATATAAATATGAATATATTCAACATAATTTGACATTACTGTGTTTGTAATGTAAATAGATGTTGTGGG
TCTTATTGCTGAAGTGATTGAACGCAAAACAGTTAATCCTGCATACAGAGTGACTGTCAAGTTGAGAGGCAACATGTATT
TTTAATTTTAACCCAGCTCTGCAGTATTCTGTGATCTCTAATCAAATTTAATTTTGTGATTCCACCCCAGTTGAGACACA
ACATGTATGTATATGTTATAGTCATGCTGAGATCATCATGACCGTGTGGGAGGAATATGCTCTTCAGCTGGATGATGCTA
TTGAGAAAAACCATTTTCTGCAAAAGCCATTGGTTGTTATGTTTACTTTTGCTAGGATCAAAGAACCCAAGGGTGAGTAT
TAAGTGATTTTCCATCTATTAAATGTTTGATTGAGTTCAATTTATGAATGCATTATAAGCGTTATATTTTTTGTAGACAA
GTATCCCCTCAGTGTACAAAATATAAAGCATGGCTCGAAGTTGTATGTGAATGGTGACATTGCAGAAATCCAACAGTTCC
ATGATAGGTACAATGAATGATTTTAATTTCATTGCTGGGTTTATAAGCAGTTTGATACAGGTATACATTTATATTCTTCA
TTAATGTAGTTTACGTGTGCCATTTTATATTGGCGGTCTAGATGATGAGGGAGGTGTTTCTCAGTCGTAGTCTACCTAGT
ATTGCCAAGATAAGTTTTTGCATAATGCTCAAATAGTAAGCTTTGGTGAAATAAAGAGTCTGCGACAGGTAAGTCTATTA
ACTATTGTTAATTTAAAATGATGAGAGTCATTATCATTTTCAAATATTGTTATTTATTATTTAAGTCATTTTTTTAAAAT
TATTTTATTCATTTTATGAACTTAATCTATTATGATATTTCTAATTTGTTATGAACTTAATCTTCAGTTACCCGAGGACT
TTGTTATGATATTTCTAATTTCTTATAATTTTTCAAAATGAATTTAACTTATTTAGGACTGTTACTATTTGACTGTTGGC
ACCGTCGATGAAGTGATGATTGATACACCAGGGAGTTATGACAGTTGTCCATACTGTACTACCACTTTTGGTCAATTAAA
AATAGGTGCAGCCTGCCATTCGTGCCAGAACCATGTTACTCACACTATTCCAAGGTAACATGTATTTTTCGCCAAATAGA
AATTGAAATAAATTTGAATTTTTGTTGTTTAAGTGATCCACATTCACTGTTTTTTGTAACAAATTTCTGTTGGTCTAGGT
ATAAGTTAGTTGTCAAGATGGAACAGAATGGGGAGAAGGCTAACTTCCATTTTTGGGATGCAGTATGTATCAAAATATTT
GGTAAAACTGCGGATGAATGTCGTCAAGAGTTGATTGCGGTAAGTTATTTATATTACAAAATGATCAATGAACACAAATG
TGTATTTAAAATGGTTTTTTATTTGTAGAGTGGTGATGAGATCAAGATGTTCCTTGCGTGTGTTGATCAATTGTTGAGTA
AAACCTGGGTTGTCAGATTCAAATACCGTATACAGATGCACCAATCATTTGTGTTGGATTTTAGTGAACAGGAACATCAT
ATACAATCATTGATATCCACGCTAGGTCTACAGGTAATAATAATTTGACCATGTCAGTGTAATTTGTAATTTTAAAAAAA
TAATTTTTTATATCAATGTATTCTTACTTGTAGGATGAACAATGTATAAGCAACAGGTCACTGGCCATTGGTGCTGCATC
TTCATCACAACAAGATTACCATCCTACAGTAGACATTTTATTTATTTGTTGATATTATTTGTTTTTAGCTACAATGACTT
TAATTATTATTGTATTGGTATTTTTATTTATTGGTATTTACTAATAATTGTTATTTACTAATAATATATTTATTGTTACA
CAGCCTTCATTGTCACAGTCAGCTGAATATGATCCTGGAAATACTGCCTTTGTAACTCCTGCAAAAAGAATGTCCGATCA
GCAAGGAAGTAGTAAGTTTGACAGTGAAGAATACGCAACATATGAACTATCCACCAACAAGCATATAAAAGTTGAGGAAT
TAGTTGTTATTTTCATTTAAAAAACTATAACCTTTTAAGTGATGTATGTATGTTATGTTTGACATGTCATATAACCTTTT
GGTTTAAAGAATTAGGTCATGATTATGATGTATTTTGTGATGTGGAACAAGTTTAATTACCGATGTATGAAGAATGAATT
GTATGGATGTTACAACTTATACCAGCATCAACCTTGAGTTAATGTAAAAAATAGATAATGCAGAATATGATAATAACAAA
ATAATAACTTTAAAATTGTTGAAAATGAAATTCGAATATAAGATTAACAACATAATACCAAACATTAATGTCTTTTAATT
CTACTTGAAAACATAGAAATCATTCAGCGTTTTCTATTGTGTTTGAATTCTTTTATGCATTGTATTAAAATGAAATTAAA
ATTGTTGTCAAATTCAAATTTGTGTAATCAATTTGTTCAGAACATTTTATGTCTTTCATTTTCATAAACAAAACTTGAGT
TTTATCATTTTAATATGGAATGTCATACTTTTATTTACATGCAGGTGTTTGAATTCTTTTATGCATTGTATTAAAATTAA
ATTAAAATTGTCCTCAAATTCAAATTCGTTTACTCAATTTGTTCAGAACATTTTATGTCTTTTATTTTCATAAGCAAAAA
ATAAGTATTATCATTTTAATATATAATTTTAATATGGAATGTGATACTTTTATTTACTTGCAGGTTGACAAGTACAAACG
TAGAATTTAAAGCTTCACATATCAATGCTGACGTAGTTATGAAGGTGACATATACTCATTTACAAAATCCGATCAATGGA
TCTTCTTGGAATTAGTGCGTATACAGGTATGCTGGATGCCTATACTTTATAATATTATGGCTATAATATACTTTATAATA
TTATGGCCATAAACCAGTACATAGTAATTATTATAGGAGATCCATATAATTAATTGAGTAGATATAGAGTATAAATGTCC
TCAGGTGTAAATTCCCAATGCACAATATATCTGAAGAAAGTTCTAGCAGTCTAATCATAATTGGGAAGTGAGAAAGGTAA
TTATGATTATAAAATTGCACTATAATTAATAAACAATTGATTACGGGAAGTGTAAAAGCCTCCCAACTAATACACAACAA
CAATATTAAATATTTTAAATTAGTTTATATAATGAATAAAATCTTTATTATTATTAACTGTTGATTAAGTGTTGATAGTG
ACACTATTAAATAGTATATTCGAAGAGATGTCACTTAAAAATCGGTTTCCAATAAGTAATAACCGCTACGGCAAGTACAT
TATGTATTTACTAAACCCCATTCATTTTCATTCAATAATAATTACAAAACCTTTAGTATACGAAAGCATAACCAACAATT
ATCCACATTTCTAATCTCATTTGTCGAAGAACATCATACAACCCTTAACAGTATGAGTACACAATCATCAACCGCCTCCA
ATGTGGTAAGTTCTTTAACTTTTCCATCCTTCGTCTTTTCCTTCGTATATGTTTTTCCATCCTTCGTCTTTTCCTTCTCA
TATGTATATGTTCAAGTTTGGTTCATCACTCATCGTTGCAATGTTGTTAGTGTATTTTACTTTTCCCTCCTTTTTTATGG
TTATTATATATTATATGTATGTTATATGTATATGCTGATTATAGACTACATATTCGTGTTGATGTTTGTAACACTATCGA
CTATGATATTCATCATGTTTATGATGTCTTTGGAAATTATGACTGTAAGATTTATGTCTTTTCCTATTATTTGTGTGATA
CTTCTTATATGTATATGTTCCATATAAATTGGTTATTGAATTCATGTGTGTATGCCTAACATGGACGGTGTTGACGATTT
TCATCATTTCCTTCCATGATTCCCTTTTTTTTTGTTTGTATATTCATTATACTTTGCTTGCATTTTGGTCCATCTTTTGT
TACATGTTTTTTAAAAATGTCTTCCAAACACAAACCCAAGTACATATATTTTTTAGTGCCTTCGTATAGCCTATTTTTCT
ATTTTGCATCATTGGTTTGTTGTAGTCAACCATTATTTTTTGTTTGTGTTGCCTTATAATCCCGCATCTGCATGATTCAG
TACCTTTTTTTTTTCCGGATCCTTATTTTATTATTTTGTTTCATCATTGAATATTAAGGTTTGTATTCGAAACATTTACG
GTATTTATTTATCATTTTCATTAGTACCTTCGTATACCTCCTATTATGTTTCATTATTTGTTTTCATTTTCATTATTTTA
TTTGCTTGCATTTTGGTTATGCCATTCAGGACCCACCTATGTTATTCGCATCCAGTATGACATACCAATTTAAGGCCATA
TTTCATGTTGACAGGGTAAGTATTTGTCATCCTCAACGTTATTTATCCATTATTCTTAATCCCACAAAAAAATAATATAT
GTTGTAATATTTACAGGATCCCAAATAAAACAGTAACACGTTTAGGTCTTTACTTCCAAAATATCGTTGAGGTACCCTCA
CTTTATCATAAACAATGGGCTCCAGATTACCCAAATTATGTGCTGTTGGACTACAATGGAAACAAATAGCATATAAGAGT
TAGAAAATTTAATAACCGAGTCTACATTGCTAATGGTCTCAAACAGTTCAAGAGGGATATAGGAATATATGAATGTGTGA
TGATTACATTTGCTGCGCCGAACAAGAATTGGAAGTTTGATATCCACTTCTCACCGCCACTCGATGCACAGACATGTGGC
AGGCCTCCCCATTCTGTCAGAAATTATGTTTTTACTGTGGATGTCGACAATCTCATGATTGCTCGACTTTATCCATTGGT
AACACTTTGGTCATATAAATTTTGATTTTGTTTTCTAATATCATACCTTTTAAATATTTACTCACTAGCTTTGTTCCAAT
GTAGGTACTGCCACCCGATGTTGTGAGTTATGTTAATGCAGCACACGAGTATATTACTGTCCTTGGTGTTCGTGGGCGTC
GTCACTTTTGGAAGTTGAGTATCCATAATGGGCTCCAATGTCTTGGTCAGCCATGGTTCCAATTCTTAACACAAAATGAT
TTGATGGCTGGTGACGAAGTTGTCTTCTATTACAAGCCCAATCAACGTGTTTGGGAGGTCATTTCCAGAAAGCAAACAAC
GAGGGACGAGGACGACTCCCCTTGATTATTTATCTTCAGAATCCACTACCCTTTAATATTTTGGTTAAAAATATAAGCAT
ATATGTTTGAATATTTTATTTAGTAATCATGTCATATTTTTAACAATTTTAATATTCCCTTGGGGAACCAAACAATTTCT
TTATTGTTAATTAAGTTTTATGAACAATATCTCGCTTAAAATTTGGATGCTATTGATTATGAATTTAGTGATTTGCTATA
TTTATGCCTTTATATGTTTGAATATGGTATTTGATGTTAATTAATTAATATGATATTTATTCCTGATTGCTTAATACTTC
GAATGTCAGTATAGCATCCCTCCAATAAGACTGAAACAATGTAATGCATACGATGAATTTAGTTTTTAGTGTTATTAATC
ATTCTGTTTGAACACCAATAGATTTTTAATTTTACCAACCTACGTCAAATACGATGACTAATATATACAACGTTAACTAC
TGTGGATATTTATAAAATATATTTTAATCAAAAAAATAAAAACTACTATGGATATTCATAAATATAGATGTATATTAATA
TATTAAATATTAAATATATCACAATAAGGCAACGTTTCCCGTTTGTCAAATCAAAAAGTACAAATTTCCAAGATTAATTA
TAACAATGTTGTGCATATCCATAAAGGCTACAACCACATTTAATGGAGCAATTAATAACAAGTACTGTGGGGTACTGTGG
GCCTGATTGACACAAGCGTATGGGCCACACAATGTTTGATCAAAGGCTTGGAGGAAAAGAAAACTGCACGAATGCCAGCC
AATGTATCGAAACCACTTCTTCTTTTTTGTTTAACAACTTCAGTGCAGAATATTAATGGAGAATAATTCATAATCTTAGT
CTCCCATCTTCAACAACATTGACTCACATTCACCACCATCTAAAACGCATATATTCATAAATGATGAACCAAAAGTGAAG
CTGCTAAACAACAGCTCCACAACAACACCACATTTACTTCTACTCCTAACTCTCAAGTAAGCTTTTTATCTTAATGCAAT
AAATTATACTTTACATTAATTATTGTCTCACTCTTTCATGTACATGTATGGGATAAATATGAGATGATGGTATTTGACTA
TGTTGATCTTACATACTCATTATGAAGCTCTGACACAATATTGTAGAACTTATTCATTACAAAAAGGTTAAATGGAAAAT
TTTGCTCAACGGAGGAAACATAGAAAACACATTTTGCAAGAAAGAAGACAAAGCTTTGGCACTCCAAATCCAGATTTACA
TAGTGGTAATAATGAATACAAATATTCATTTAATTATTACTTATTTTATAAATATTTATGCATGTATGACAACTGTTGGT
GCAAAAAAGCGTACCCGGACCTCACCATGTGATGCACACCTTTTTGTAGACAGTGCCTTACCGCATACACAATTTACACC
ATTATCAGAAAGCACTTTGTCTGCGAATCAGACAGAACAACATTTTACAGAGCAATTTGAAACTCGACCGAAAAATTTCG
TCAATTCACGTACCATCAATGCTTCTTCGATACAGAGGAATCTGTTGTCCAAGTTTGGAAAAGAGAATTTAACTTTGTCA
AACCTTAATTCATCACCATCTATTGCAACACATACAACTACAGGTTGTCGACCTATGCAAATTGGGACGACTTCTCAACA
TATAAATTCAGGAAGATACACAATACTCAATTCCAAACTAATAGAGCACATCTCAGATGACACTAATGACAAACTCGATA
TAACACAGGGAGACATTGTTACAGGTAATATGTTATGTTAATTACAACATTTCAAATTTCCAACCATTTGTATTTAACTG
CTGACTATGTATGTGTTATATAGATTATTCATTTGACGACCCAGCAACTGAGGATGTTGTTGATACCGATGATGATAGGA
ATCTAGACGCACCATATCACAATGAAAATACCAGTTTTTACATTCAATGTCCAACTTATGTTGTGTTGCCCTTCATTACC
TTTGATAATGTACACAATCTAAATTTCTGCATCTAAATGTAGGTGCAGGTTACAAGGATATTGGAGATCCAATTTTGCAA
TGCAAGCAATGTAAAGCTAAGATGTGGTATGATGAGAGGATTAACAAAGATAAACAGACAAGAAACCTAATGTTTACATT
ATGTTGTGGTGATGGAAAAATACAACTGCCAATACTACATGATGCTCCGCAGCCATTGCGGCAACTACTCTTTGACACCA
GAGACTCACAAGCTAAGAAATTTCAGCAAAACATACGTTTATACAACCTAATGTTTGCATTCACATCTCCAGGTGTCAAA
GTAGACACATCCTATAATACTGGAAGAGGTCCTCCTACATTGCGCATACATGGTCAATCGCATCACCTCATTGGAAGCCT
CCTACCTATGCCTGATAACTCGCCAAAGTTTGCACAACTATATATTTATGACATTGAAAACGAAGTCAACAATAGGCTTT
CACAATACCCGTAAGTCTAAACATTCGACTAAACTAATGTCACCTTTATAGTTATTTAAATTTTGTTTTTAAGAATGGTT
ACCATTAACAATTGTCTATGTCTAGTATAAAAAATAATGTTGATGAAGACATTATAATTGGCATCAAGAATATGCTAGAT
ACCCACAATCGATATGCACAAAAATTCAGAATGTCAAGGGACAAACTACACTCTTCTGCAGTGTGCGACCTGAAACTAAA
GCTCATTAGTGGCAGACAATCAGATGGCAGATTATATAATTTGCCAAATGCTACTGAAGTGGCTACTTTGATTATTGGTG
ACGAGCATATAGTAAATAACAGAGATATCATCATCGAGAAGCAAACAAGCATGCTCCAAAGAATAAATGAACTTCATCCT
GCATATTTACCTTTGCAATATCCTCTTTTGTACCCACACGGTGAAGATGGCTACAGACCAAACATTCTTCATAAGGATAA
TCCGCATAGCCAAGTTGCAAAGAGGAACAAAGTTACCATGTGTGAGTATTTTTGTTACAGGATGCAATCAAGGGATAATG
AAGCACAAAGAATACTTCATTCAAGAAGATTGTTTCACCAATGGGTTGTTGATGGATATTGTATGATTGAGTCTCAAAAA
CTAAACTATGTTAGACAACATCAACAACAACTCTGAGTTGACAAGTACATCAATTTAAATGACTGTAATAATCAGCCCCT
AACCCAAGGCAATGAAAAAGGTAAGAGAATTATAGTACCAAGTTCATTCGTTGGTAGTCAGAGATATATGGAACAATTGT
ATTTTGATGGGATGACAATTTGTACCCATGTTGGATTTCCTGACCTATTCTTGACATTAACGTGTAATCCAGCATGGCCA
GAAATGCAACGACAAGTTGCAAAGTCAAATCTTACTGCTCATGATTGCCGTGATGTTGTGTCACGGGTATTCAAAATGAA
AATAAACTAGTTAATGAATGATCTTAAAAGTGGACATGTGTTTGGTCCCATTCTTGGATGTAAGTAATTACCAACTCCAT
CAATTTTTTCCTACATTTCAATTATACAATTATAATTTGAAATATACATTATGAATGATGCTACTGATATTTTAATTGTA
ATACAGTTGTTTACACCATTGAGTGGCAAAAAAGAGGATTGCCTCATGCTTATATCTTAATCTTTTTGCATCCTTCAAAT
AAGTATCCAAATGTAGAAGACATTGACAACATAATTTCTGCTGAGATACCAAACAAGGACACACATCCAGAATTCTATCA
AATTGCCTCCAACCATATGATGCATGGACCATGTGGACTGGCCAACAGAAGGGCACCATGTATGGCCAATGGCAAGTGTA
TTAGGTTTTTCCCAAAAAAGTTCCAGCCAGCCACAATTGTTGACCAAGATGATTTTCCTGTTTATAGGAGAAGAGACAAC
AGACGAACCGTGCAAAAGCAGGGTGTTCAACTCGATAATCAATTTGTTGTCCCATATAGTCCACATTTGCTACTCAAATA
TAGAACACACATAAATGTGGAATGGTGCAATCAAAGTACCTCAATCAAATACATGTTTAAGTACATCAACAAAGGATCTG
ATCGGATTACAACGGCTATTGTTAATGCACAAAACTAGGATGGCACACACAATTAGGTTCATGATGAAATTAAACACTAT
CTTGACTGTCGGTATGTGTCCATCATCTTCTCATTAAATGCATTTCATCTATACACCAAAAAACCCTTTCTTATTTCATT
AATTAATAATTACTACAAATTATGTGTTCATATTTTATTAATCATTTGCCAGGTATGTGTCGGCTCCTGAAGCATGTTGG
AAGATTTTCGCATTCCCAATGCATGGACGTGCACCAGCAATTGAACGCCTCTATTTCCACCTAGAAAATCAACATCTTGT
TTACTGGAAAGATAGTCAAGATATTGGGACAGTACTGTCTAAGAGTACAATCAAAGAATCAATGTTCACAACTTGGATGG
ATTCTAATAAAATATACCATCATGGACAAGATCTTACTTATGCTGAATATGTGTCCAAATTTGTTTATAATGCATGCAAA
AGATGCTGGAAACCAAGGAAACAAGGAAATACTATAGGCAGGCTCATTTGGGTGCCCCCTTCTAGTGGAGAGTTATTCTA
CATGAGGATGATGCTTTCCTCCGCTAAAGGATCACAATGTTACGAAGATATTAGAACAGTAGAAAATGTTGTCTATCATA
CGTTCAGAGAAGCATGCTTTGCAAAAGGTTTTCTAGGAAGTGATCAAGAATTTGTTGGTGCCTTACAAGAAGCAAACAGT
TGGGGAACTCCACACTTCCTTAAGAAGTTATTTGTGAAGCTTCTATTTATGAATACCATGGATAGGCCAGAATATGTGTG
GAAACAAAGTTGGCAATGGATGGCAGATGATATTGTATTTAATCATAAGAGACAAGGTAATTTCATCAATCCTAAATAAA
TATGTATCAATCATAGCAAATAACTCACTTACTGACAAATGTCATTTTTGTACTATTCATAGGCATCCAACTCACAGACA
AAGAAAAAATGCATCTTTGTTTGACGGAAATTGAAAACCTCCTGCAAGCCAACAGGAAAAGCCTATGAGATTTTCCTTCA
ATGCCATACCCACTAGGATATGCCGCCAACCCGCACCAAAATAATCTCATCTACAATGAACTGGGTTACGACAGAGACAT
ATTATCTGCTGAATTTGACAAATGCTATCAGTCGCTAACAGGTATTTACAAAATATTTAACTTTTTACTAACACAATATG
GATGCCCAACAATCCACACTAATAATACATCATGTATACATTACTAAATGCAGATGAGCATGCTTCTATTTTTAATAAGA
TTATGCATGTGGTTGCAACTCAATCAGGTGGAGTTTATTTTCTCTATGGATATGGTGGCACATGTAAGACATTTGTGTGG
AAAACTTTATCATCTACTATACGCTCTACTGGTGGCATTGTTTTAACAGTGGCTTCAAGTGGGATTGCCTCAATACTATT
GCCTGGGGGTAGAACAACACATTCTAAGTTTGCTATTCCAGTCCCTGCAACACAAAATTCTACATGTAATATCCATCAAG
GGAGTGATTTGGCTGAATTGTTGCAGATCACAAAACTCATCATATGGGATGAAGCTCCAATGTGTCACAGATACAGTATT
GAGGCCCTTGACAAAAGTTTACGGGATATCATGCACAATGGAAATCCTTTTGGAGGAAAGGTCATTGTTTTCGGTGGTGA
TTTTCGTCAAATACTACCTGTTGTGCCAAGAAGTAATCGCTCTAACATTGTCTATGCAACTCTAAATGCATCTTACATTT
GGAACCATTGTCAAATTCTAAAGCTGACAAAAAATATGCGATTGCAATCAAATCCTACTGACCATTCCAACTTTGATGAA
CTAAAACAATTTTCTAAGTGGCTCCTAGACATAGGCGATGGTAAACTTGTAGAACCAAATGATGGCTATGGTGAAATCAC
CATCCCAGATGAGTTTCTTATCAAGGAGTTTCAAGATCCTATCCAGGAAATTGTTGAAGCAACATATCTAGACTTATTAC
ACAACTACAACAATGGAGATTTCTTGCAAAAAAGAGCTGTCCTGGTCTCTACAAAAGGTGTTGTTGACAAAATAAACAAC
TATGTCTTGTCTTTGATTCCTGGTGAGGAGAAAGAGTATTGTAGTGTTGATTGTGTTGACAAATCAGATGAACTACTCAG
TCCTGCTTTTGGAGTACTAACAACTGAATTTCTAAACTCATTGAAGACATCAGGAATACCCAATCACAAGCTCAGAATCA
AGGTTGGTACTCCCATCATCCTACTGCGAAATCTAGACCAGACTGATGGGTTATGCAACGGAACTAGGCTTATTGTTACA
CGACTTGGTTCAAGTGTTGTTGAAGCGGAGATTATTACTGGGCCCAACATAGGTCATAGAACATACATACCAAGAATGAA
TCTTTCTCCTTCTGATTCACCATGGCCATTCAAGCTAATTAGAAGACAATTTCCATTCATGGTTTCATTTGCAATGACAA
TTAACAAATCTCAGGGGCAGTCGTTGGCACATGTTGGATTGTATTTGCCAACCCTAGTTTTTTCTCACGGCCAGCTATAT
GTTGCACTTTCACGAGTTCAAAGCAAAAAAGGCTCCACATTCTTATTCATGATAATCAAGACACTCCCAAAAATACTACC
ATTAATGTAGTATACAAAGAAGTTTTTGCAAACTTATAAACATGGTATGATTCCCAAATCCTTTTTTTTTCATGTACATT
TTCATTATTCAAATTCATTTTCTATCAAACACTAATTGTTAGTTTCATCTTCAGTTTATCAATTTCTAATCATATAATTA
AAATATACTATGCTTATTAGTATACCGTTACTTATATTGCAGTTGACATACTATAGTGCAATTTCATTATCATCAATCCT
CAAATAATTTTGACATAATACTTTTATTTCATTATTATTAAATCACGCCCACTACTACATGTTCATATCAACTTACGTTT
TTTAGCTTAGTGTTGTTGTATATCGTACCTAACTCCTGCATACAAATTCCAAATATTTACTGATGTTATTTACATATGCA
ACAACTCATTTATTTTTGTTTATTGTATAGTCTCCCACTCCATACATGATGTTACCATCATAATCTTACCAGCACCATCC
AAAACATTCTACCATACAATTAGGTTAGTTTCAAATACATTCCTAAATTAATATTTTCTTTTCCTTACAGATATTTCAAC
ATTATTATCGTCCCATTAAACAAAATTTTCAAACATTATACATATATATTGACATACTTTGCATTTATCAATACTCAAAT
AGAAGTATGAGCCCGTGGATCGGCACGGGCGTCTCTCTAG





USDA Logo
Iowa State University Logo