SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   DTO_uuu_Gm9-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   II
Subclass   I
Order   TIR
Super Family   PONG
Family   Ukn
Description  
Chromosome   Gm09
Start Position   18457732
End Position   18462065
Sequence   TAGCATTTTCAATTCAAGAAATTTATATATGGTTTCTTAATTATTTTTTTGTGGTTTTCGCATTATTTTGTATGGTTCTG
CTGTATCATGTTATTTATAAGAAATCCATATAAAATTTTATTTCAATGCAAGAAATAATAAGAAACAGTAAAAAATTTAA
ACATTTAAATTATTTTATTATAATTTAATTATTATTCCAATAAAATAATTAATTCATTTTTTCAATTTTTATGTATACAA
ATAATAAATATGAATAAATAAAAAAATATTAAATATAAATTAAAAATAAAAAATTACATAACATTTAAAGGAAATGTGTA
ACAATAAAAAATACATTTTTACATAATAATAGATATTTAAATACAATGACATTGAAATAAAAAACATAATTATGAAAAAC
AAAAAATATTACATTAAATTAATTCTTATTTTTATTTCTGAAACATTCCTAAATATGTTCAACTAAATCTGCTTGAAGTT
GGCAGTGTTTTTGTTTGTCAAGAAATTGTGCTCTCCTCTGAAAGTATGTTGATCTGATACTAGGGTGAGCACCTAAAGAT
ACTTTGAATGTTGAAGTGTTATTACCTACACTATCGTAATCAATATTATTTTGATATGTGTCACGTTCGTCCTCAATAAT
CATGTTATGCAATATGATGCATGCATAGATGATATTCTTCATTTTACCAACATCCAAAAAACGTGACGGACCACGTATAA
TTGCAAATCGAGACTGGAGCACTCCAAACGCTCATTCTACATCCTTTCTTGCCGATTCTTGTCGTTGTGCAAATAATTTT
CGTTTTTCTCCTTGTGACATTGAGATGGTCTTCATAAACGTGACAAAGTCTGGATAAATGTCATCTGCTAAATAGTATCA
CATATTATATTAGGTTTTATTCACCATGAATTGCACTGTGGGCACACGTCCTCACAAAACTTCATCAAACACATTAGATC
CATTTAACACAGTAATGTCATTATTTGAACCGGCGGTTCCAAAAAATGCATGCCAAATCCATAAATCTTGTGATGCCACG
GCTTCAAGAATGATTGTTGGGTTGCGATGATCATCTCGACAAAATTGACCTTTCCAAGCAACTGGACAATTTTTCCATTC
CCAGTGCATACAACCAATGGAACCTAACATACCTGGAAATCCATGTGCTGCTCCCATTTGTAGTAGGCGTTTGATGTCTT
CATTATTTGGTCTCCTCAAGTATTCATTCCCAAATATGGTGCAGATGCCTAATACAAATCGCTCCAAGCATTCCACTGCA
GTGGTTTCACCAATTCGAACGTATTCATCGACACTGTCAGCAGGTGATCCATAAGCCAATATATGAATAGTAGTTGTGCA
CTTCTGCAATGGAGATAAGCCTTTTCGACGTAGTGCATCGACCCTCATTTGAAAGTATTCATCATGGTTGCTGAGTGCAT
TTACAATTCAGAGAAACACATGCCTTCGCATACAAAACCTTCTCCGAAATTGAATCTCTGTGTACACAGGATTTTCTGAA
AAATAGTCATTGAACAATCGATGATGACCTTCTTCACGATTACGATGTACCACTCTTCTTCTTTGGCTACGGCTAGTGGT
GTTGCCATGTAGTTGTTGTTGGCTCTCAAGTATCAACCTAATGATTTCTTCATCGCTATTATCTTCTAATTCCTCATCTA
TCATTTGATCTAAAACTTCATCTAAATCGATGGTTGGATCCATTATATGGTAACCAAAGTGTTTGAAATAAGAGAGAAAT
ATTGTATGAGAGTATGTCAAAATAATGAAACATTGAACATTTATATAGCTTCATTAGTAACAGCTAGTTTATCAACGGCT
AGTTTTTCAACGACTAGTTTTCAACGGCTAGTTTTTCAACAGCTAGTTTGTAATGACCAATTTTATAACAACTATTTTCA
TAACACTAGTTTTACAACATAAAATTCTGAATTTAAGACACAACAAATACCTATATTGCTAAAATTAAATATCAAACACA
ACATTAGCGTAAGAACTAAAAATTTAATATCCTAGTTTTTTCCTAATATGGTCACAATACTTTTCGTGGTCTTTGCGTTG
TTGTTCAGACATGTTGGAAGTATCCTTCATGAGGATTTCATACTCCATACGTCGTTCATGTTCTTGCAGACGCTTTTCCT
GTGCCTCCTTTAATTGAATAAGTTTTGATGTGTTCATATTTTTGTCCTTCATTACACTTTCTATGCCAGATAAATCGAGA
GTGTTAGGACATTCTTTCCCTTTGCTTTTCCTTTTTGTTGCTTTTTGTCCAATTGGGCGAGACATTGGTGATGGCGTATC
ATATTCTTCGACTTCAATGGGTGTCTCTAGGTTAGAAGACAACAAGTAATTTCCAGAAGTAGAAACCTTTGTTCTTTTTG
AACACTTTGACATAAATTCTGCATCAAATTTTGGTTGATCTTTCAACAACAACCAAGCATGCTCAATCTCAAATTTTTTA
CCTGTATCTTGTGAGTAAATCATATGAGCATCAGCCAAAATATCCTTCTCTGAACTTTCACTTCTCCTATGTTTATCTGC
TTGTTTGTAGCACCCATTAAACTTTTGAACGGGAGGATGGATCCTGTTCCACCGAGATTTTAATTGAGTCCAGCTTCTTT
CACAAAATTGTCCACTTTGATGCACATCGTCATTATTGTACGCATTTTTTATCCTTGCCCAATATTCTTTGATGTTTGGT
CGACTCCTATAATTGAATCCTTTGATACATTCAACCATGATCAGACGAGAATCACATCTTCCGTGACCGAGAATGCGGTA
GGACTTTTTTTTCCACTTGAATTTTCATCTCCTTCATCTAGTTGAATATCGTCTACACCGACGGATGATTCAATTTCATT
GCTAGGGAACACAATATTGGATAAAGAAGGCCTATAACATGTGTTTGAGTTGGTGGGAGTTGATGGTTGACTATAAATTT
GTGGATTTTGAGAACTACCACTAGTAGGTGGCTCTACATTGAGTGAAGGATGCATATACCAAATGTGTGGGGGTGGTGGA
TACATAATATACTGTAGTGGATTTTGAGAATTTTCACTGGTAGGAGGTGGTGGTGGACACATAACATATTGCGGTGGATT
TTGAAATTTTTTACTGCTTTTAGGTGGTCGATACATAATATATTGCGATGGATTTTGAGAATTTTCATTGGTAGGGAGTG
ATTGGTTTTGCAAATAATTATAGTAACATTGATAATTATACTGATTAGGATCCATTTTAGAGAGAGAGAAAAATTGACAC
TTGATAGCAACAAAAAAATTAGTAGTACAAGAACGGTGAAAATATGTTGTTCCGTGCATAAATTTATAGTGAATAAGCAA
AGTGAAAACATTTCCATAGCTCTGCACTTCAACGGTATTATTTTCAAATCAACGGTCAATAGCAATGGTAACATTTCCAT
CAATAGTCAAAATCTTTCTTAATTAATTATCTCAATTGTTCAACGGTTCAGATTCATCCTCATTAATAACATGGACGGTC
CAGATCGTCTCACCTCATTAAAAAGCTACCTACTTCTTTTCTCGATAATTGTTTTTCTCTCTCCAGCACGTCTTTTCTTC
TTTTCACGGTAAACTTTTTTTATCTCTCCAACAACACCTCCAGAAGCTTCCCCCTCTCCTCCTCTCTATCTTCTTCCTCT
CCTCCATGGCCACATTCGTCAACACCTCCGGCCACCACCGCAACACCTTCCCGTGGTCTCACCTTCACTTTGCGTCACCA
CCTCTGGCCATGGTAGCGTCTCGCGTCACCTTTGCTGGCATCAACAATGAAGCACATGGTCGGGTCTCCAAAAATGGTCT
CGTCTCCGGCCATGGTTGTGTCTCCGGCCATGGTCGCATCTCTCGTCTCCATTACGGTTGCATGTCGTGTCTCCGGCCAT
GGTCTCGTCTCCGTCTTGGTGCGTTTGCCTTCACCTTGATTGCGTTTGGTTTCTCCATTTTTTTTCCTTTACTGTTTTGC
TTGAATATGAATTTAAATAACTTTTTTTTCTAATTTTATGATTGTTGGGATTTATTGCGGTTGTTCAACGAGTATATATG
TTCCATGTTCTTCCCTTGACAATTTTATTTTCCCTCTTGTTGAAGCTAAGAAAATCAATTTTTTATTGTTTACATATTTG
TTATGTCTGAGAAAATTATTTTTTTAATTGTTAAGTATGGTTTCTTATATAAGAAACGATTCTCAGCCATGAAGAAATGC
ACTCTGCCACGTCAACTTGTTCCAATGCAAAAAAAATTAAGAAACGGTTTCTTCCCGTTAAGCACCTGGGAAGAAACTTG
AATTGGAGATGCTC





USDA Logo
Iowa State University Logo