SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   DTT_uuu_Scaffold95-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   II
Subclass   I
Order   TIR
Super Family   Tc1-Mariner
Family   Ukn
Description   MITE/stowaway
Chromosome   unanchored
Unanchored Scaffold   95
Start Position   837
End Position   1126
Sequence   CTCCCTCTATACTCATATATAAGCAAAAAAGTCCCCTTTTCTTGGACTCAAATTAAGAAAATCTAACTAATTTCACCCCT
ATTTATTGATGTCATTCCTAAAACAATTTTCATTTAATTGTAATTCAATTTTTATGGAGTCATTTTTATTCAAGGTATCA
GATTTGAGTGGAGGACATTTTAAGAATAACCTTACTTTCTACTTGAGATTAGTAAAATTAAATGATTTCAACTAACTTTC
TTAATCTATGGGAAGTAATTATTTTTGCTTATATATGAGACCAGAGAGAG





USDA Logo
Iowa State University Logo