SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr539_Gm9-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr539
Description   INTACT
Chromosome   Gm09
Start Position   13619105
End Position   13631660
Sequence   TGATAGAGGGGGAAATAGATGGGGAAAGGTGTATGTCAGAAAATATCCTCGGAAGAGTTAGAGAGCTGTCAGTTTGTTAG
GACAGCTAAGATAACTAACTGTTAGTTAGTTATAACCAATTGTTAGTTAAGAGGCTATAAATAGCATTGGAAGGGGTTAG
TTAGAGGTTAGACAGAAAACTGGAGACAGTAGGAGGGTGATGAGACCATCACTGTGTGTAACCATTGTGTTGTAGCATTT
AACTCGAATAAAAACAATTTTTCCGCTGGTTTGGTCCAGTTCTATCAACTAGTATCAGAACTCTGATCTTGGAGTGTAGA
ATCGTTAATGGTGACAAAGGCGAATGCAAGAATGGAGACATGCATGGAAGCTATGGAGAAAGCGATAAAGGAGAATCGTG
AAGCAGTGGAATTGCAGTTGAGTTCAATCGAAGGGATGATCCAAAGGTTGGCGGTGGCATGGGAGAAAAAATCTCCTGCG
TCAAACGTGCACGCAGTTGACGCGAGTGGAGGAGATGAAGGTATGACATCGCATGACGGCAATCAGTGGAGGAATTTGGA
ATTGCCCATATTCGACGATGAGGATCCTATGGGCTGGTTGACAAAGATCGAGCGATATTTCCAGTTACGCATCGTAAGGA
AGAGGACAAGCTGGAGGTTGTAATGGTTGCGATGGATGGGGAAGCTTTGGGTTGGTTCCAATGGTGGAAATCTTGGAATC
CAAATCATTCTTGGGATGGGTTCAAGATTGCTGTCACCCAAAGGTTTCAGGCTTCGAGCCTGGGAAATCCTTTCCAAGCA
CTGCTGGCACTGGAACAAGAAAAGACAGTGCAGGAATTCATAGGTCAATTTGAGAAGTGCATTATCATGGTGAAAGGGTT
GGAGGAGCCATTTTGGTGGAAATGTTCCTTAAGGGGTTAAAGGAAGAGATTAGCACTGAGGTAAGGCTTCATGAACCAAA
GAACTTGATGGAAGTCATGGTTAAGGCTCGAAGAGTGGAAGATAAGAGCAGAATTTCAGGGAAGTTACCCGTGGGTAATG
GTAAAGGGAGTAATCTGCAGAAAAACGTTCATTCGGGACAGAAATTGGTAAGGGATTGGCAGCCAGCAAACAATAAGGTG
GCTGACCTTCAGAATGCTACAAAAACAGGGACAAGTGGTTGGAAAGGTAGAAGAACGTTCCACAATTTGTCGCCTGCAGA
GGTAAATAAAAAGATAAGGAAGGGAGGGTGTCTCACATGCGAGGAGAAGTATAATCCTACACATGTGTGCAAAAATAGAC
AATTCAGATTAATGATTATGGAAGAAGAGGAGGAAGGAGATCCTAAGGGCCAGCAATGGGAGGATAAGGAAGAAGAAATG
GGGGAGTTTCACCAATTATCCCTGCATAGTATTGAAGGCTTTACCATCCGGAAATCTCTTAAATTGTGGGGAAAAATTAG
AAATAAAAGGATGATTGTGCTAATTGATTGTGGAGCCACTCATAACATCATATCGGTGAAGTTAGTTAAGGAGCTAAGGT
TAGAGGTAACCCCTAGAAGCTCATATTCTGTAGAAGTAGGAGATGGGCACAAGGTTAGGTGTCAAGGAGTGTGTAGATCC
TTGCCTATTGAATTGCAAGATTTACAGTTCACACAGAATTGTTACTTGTTTGAATTGGGTGGTGTGATTTGGTGTTAAGG
ATGGAATGGTTGGCTGGATTGGGGCAATTGAGGCCAATTTTGAGAAATTGACATTAACAGTGCCAGTGCAAAACAGAAAA
GTCATATTAAGGATTGAAGCAGAGTTGATAAAAGCTTCCATTAGCATGAAAATGATCAAGGAGACCATGATGGAGTCTGA
CCAAGGGTTTATGGTGGAATTAAAAAGGGTGGAGGGAGAGAAGTGTGTGGAAGCAGTTCCTGACCAAATGGTACAACGGC
TGACACAGTTTGAACAAGTTTTTTAGGAACCTCAAGGGCTACCACCACATCGGGAGAGAGATCATGCTATCACTATCCAA
GAGGGAACTAAGATTCCCAACTTAAGGCCCTACAAATACCCACATTACCAGAAGGATGAAATTGAAAAGATGGTAAGAAA
TATGCTAACTGCTAGAATTATTAGAACTAGTACTAGTCCATATGCTAGTCCAATTATTTTAGTTAAGAAAAAGGATGGGA
GTTGAAAATTCTGTGTAGACTATAGAGCACTCAACAAAATTATTGTGCCTTATAAGTTTTCTATACCAATTGTAGAGGAA
TTATTGGATGAAATTGGGGGGCTGATTGGTTTTCCAAGCTAGATTTGTGTTCTGGGTATCATCAGATTCGAATGAAGGAA
GAGGATATCTAGAAAACAACTTTTAGAACTCATAAGGGTCATTATGAATTCTTGGTCAATGCTTTTGGGTTGACTAGTGC
ACCATCCACCTTTCAGGCACTTATGAATGAGGTGCTCTGGCCCTTCTTAAGGCAATTTGCATTAGTATTTTTTGATGATA
TACTTGTATATAGTAGTAGCCTTGAGGACCACCACATGCATTTGAAAGCAATCTTACAAGTTTTGCAGCAACATGAACTA
AAGGTGAACAAGAAAAAATGCAACTTTGGTAAGAATTCATTGGAATATTTGGGACATATCATCTTAGGAAATGGTGTGGA
AGCTGACCCTAGTAAATTGGCAGCAATGGCTGAGTGGCTAGGCCTAACGATGCTAAAGCATTAAGAGGATTCTTGGGGTT
AACAGGGTATTACAAGAGATTTGTGAAAGATTATGGGAAAATTGCACAGCCCTTGAATGCACTGCTCAAGAAGGATGCAT
TTCATTGGAGGGAAGAAGCTACTTATTTGAGGTATTTAACTGGCACCAAACCAAAACAGTAGCCTAACCACTTGGCCTGG
GCTGAATTCTGATTCAATACCAACTTCAATATCTCTACCAAGATGTCTCCTTTTAAAGCTTTGTATGGACAGGAATCCCC
ACTTTTAGTTAAAGGAGCTGACATCCCTTCCAAATTGGAAAAGGTAAATCAGTTGAGTAAGGACAAAGATGAATTATTAC
AGGAACTGAGGAACAATCTGCTCAAGACTCAGGATCAAATGAAAAGATCTGCAAACAAGCATAGAAGGGAACTAGTCCTG
CAGGAAGGAGATTGGGTCTTTTTGAAACTACAACCTTATATAATGAAATCTCTAGCAAGAAAGCCAAATGAAAAGTTGAG
TCCACAATTTTATGGACCCTACAAGGTGATACAGCGAATTGGGGAACTGCAGGTTCAATCAGAGAAGGTCATGCAAAGCA
GAATTTCAAATGATGGCACTATGGCAGAAAGGAGGTTCTCATCAAATGGCAAGACTTACCCCACCATGAAGATAACTGGG
AACTTGTTGATGAAATGCAAACTGTTTTTCCTCAACTTGACCTGGAGGACAAGGTCCATCTTGAAGGAGGGTACTGATAA
AGGGAAAAATTGTTAGGAATTTTCTTTATTTTACTAACTACAACTAGAGGTAGAACTTACGCACACAAGACAGTACACGC
AGAGATAAAGGATTTGTTATTATTGCTAGTTCTTTCACTCTTTACACAAAAAAGAGCACTTTCTTCCCTTACAACACTGA
GACACTTCTCAGGTTCTCTCAATACAATCAATTTCTCCCCTCTTTTCTCCTCTTGTAGAAAGTTGTTATATATTCAAAAC
TACTAACTAACCTGCCAGCTGTTGACAGCTGGCAAAGTCTAATTAACTTCCAACAACCTAACTGTCACTCCTCCAATCAA
TTTCTCCCCTCTTTTCTCCTTCTGTAGAAAGTTGTTATATATTCAAAACTACTAACTAACCTGCTAGTTGTTGACAGCTG
GCAGAGTCTAACTAACTTCCAACAACCTAACTGTCACTCCTCCTCTTATTCTTCCTACTATACCGTAGCAACTGCGATAC
AGTAGATGATTCCTCTTGCCTAACAATACCCCCTGGAAAAGAACCTTGTCCTCAAGGTTGAAAGCAGGGAATTGTTGCAT
CATATTTGATCTATCCTCCTAGGTTGCTCCTTCAACATGTTGTCCTTTCCACTTGATTAATACTTGTGGAATTTCTGTTC
CTGTTGGACCAAACATTTTTGTTCCTAGAATTTGTTCCGGTTGTATCCCTTGTTCTATAGCTTGTAGTTCCTTTGGAAAT
TTTGCCTCAATTTGATGTTCTCCCGCTGCAATTTTCAATTAGAAAACGTGAAAAACAAGGTGAATTTGAGCAGTGTCGAG
TAATTGCAACTGAAATGTTACAATTCCAACTTTTTAAACTACCCGATAAGGGCCATAGTATCTGGCTGATAGCTTAGGAT
TTAATCTTGTAGGCATTGAAGCTTGTCGATGCGGCCTTATCTTGGGATACACCCAATCCCCCTCCTTAATCATTGAAGGT
AGGCGATGATTATTGGCATACTTTGTCATGTGATTCTGGGCTCTGTTTAGATGAAACTTCAACTGATTAAGTGCTTCATT
TCTTTCCATAAGATCCCAAGCCACTGCCTCAACTAGGACTTCCCCTGGAATGAACCTTGCCAAAGATGGGAGTGCTCAAC
CATAAACTATTTCAAATGGGGTACACCTTGCAGCTCCCTGATAACATGTATTATACCAGTATTATGTCCATGGGATAAAC
TCAACCCAAGATTTGGGTTGCTCTGCATAGAAGCATCTCAAATATGTCTCCATTGTTCTGTTTAGTACCTCAGTTTGGCC
ATCTAACTGAGAGTGATAAGTAGTACTCATTTTCAAAATTATTCCTTGTTTTTGAATAACTCCTGCCAGAAATTACTCAA
AAACAATGCATCCCTGTCATTTACTATTGAAGAAGGAATCCCATGCAGCCTTATTACTTCCTTAGTAAACATATCCACCA
CACTCCTAGTAGTATAGGGATGCTTCAATAGTAAGAAATGACCATATTTACTTAGCCTATCCACCATCACAAGAATAGCA
TCATGCCCCTTAGAGTTAGGTAATCCCACAATAAAGTCTAGGCTAATATCTTCCCAAACAACATTGGGGATTGGCAATGG
TTGTAATAAACCAGCTAGTGAAGAAGTGAGGTACTTACTTCTTTGGCAAATATGGCATGCTGCCACTAAATATGTAATAG
TTTTGAGCATTCCTTTCCAATGAAGGGATTGTGCTAGCCTTCTATAAGTCCTACACCCCTGAGTGGCCTCCTGCCAAGGA
AGAGTGAAATTCATTAAATGGCTGAGTGAGATCCAGCTTGAATTGGTAGGCAGTACCAACTTGCCTTTAAAGTATAATAT
GTCATTCTCTAGGGTGTATTTGCCATGTGAATCCATAGTATCCAATACCCATAGAAACATGACCAATTCAACATCTATAT
GCTTGCAAATTGATTGCAGAGACACTTTAGTTCATAGCAGTTTAGGATCACCTTGAATTTTGACTAACTATCCTTGTGTT
TGAATTGCATGGTCAGAGATTTCCAATTTACCTTGACATCTCCTAACTTTTCCAACCATGCTACCCCCAATATGACATCT
ACACCACCTAAATCAAATAGAAAGAATTTCTCTGTTATGGTCATTTGTCCTAACTGAACCTTCATCTGCTCACAACAACC
TTGAGCATTTTTCTTGTTTCCATCACCCAATCTCACTCCATAGGTTTGAGTAGGAGCCACTCAAACCCAGTTGTTGCACT
AATTCTTGAGAAATAAAGTTGTGGCTAGCACCACTATCAATCAAAATCAACATTCTTTTGCCCTAAATTAGCCCTTCCAA
TTTCATTGTTTGTGATTGAGTAAATCCACCAGCTGAGCAAACGGATAAGTCCATCCATTGACACTCCACCTCTGTTTCTC
CTATATTGTCAAATGTATTCTCAAGCTCCCCCTCCAATCTTGTAATCTCCTCATTATTAATTCATTCATCCTCTGCCAAA
ATAAGCAACCTAAGGTTTTTTCAAGGCACTTGTCACCAGCAACAAATGGAACTCCACAATGATAACAAAGTTTTGCTCCG
CGGCGGCGAAGGTACTCCTGGTAGGACAGGTTCCGGACTCCACTATTCCACGTTCCCGAGCTTGTAGACTCACTCTGATT
TGCAGCCATTACGTTCGCAGAGCTATGTGCCTCCCCTGTTAGAGTTCGATTCTGACATTGGTTGTTGTGAAAGGTGTTCA
TTGCGGATCCTCCAACATTGTGTATCCACGTTCCTCCCTTGGGTTGAAAATGAAACCCACGACTACGCAAGTCGACCTCT
GGATTCCCTTCTTTCTCAGCTTCCTCAAAATCAGCCGCCAACTACATGGCACTTGACAGATCCTTCGGTTTGTGGGGACG
AATTTTTGCCCGGATCTCCTTGCGAAGTCCCGCCAAAAAATATCCTCTCAATTCCGCTTCCTTTGTACCCGAGACTTGAG
CCACCAGCACCTCGAATTCCTGAATGAATTCAGTCACGGTCCCCGTTTGGCGCAATGTTTACAAACGCTCGTCAACATCT
CCCCTTCCGGTACCGCCATAGCGCTTAATCAGCACTGCCTTGAAAACAAACCAACTTTTTCGCTTTGTCTTTTGCTTCCA
ACACTGGAACCAATGCAAGGTGTTTCCTTCCATGCTGATAAAGGCCAATCTCACTTTCGGGCTCTGTTGAACATGTTGCA
CTGCAAAAAACTTCTCCGCACATGTGATCCAACCTAACGGATCCTCTCCTTCAAACACTGGCATTTTCACCCCTTTTGCC
CAATAATGGCATGACGAATTCAGTATTGAATCCGCCTCAGACTTGCTCTCTTCGTCCTCCGATGTTGATGAAGGCTCGGG
TTCCATTGCGGACTCCTCATCCTCCAACCCACTGTTTTGCTCCGTAGATGCATTCTCGGCATCATTATACGTGATGCCTT
TTTGTTCCATGAGCATCTTCATCATCTTGCACAAATCTTTAATATCGTCACACTGTTTCAACACCTTCGCAATCACCTCA
GTTTGTTACTTAGACGATTTCTGCAACTCAATGGTCATCACCTTCAATTCGCTGGTTGTTGTTTTCAATGCTGCAACTGA
AGATTCCAGTGCAGTGAATGGAGCCTCGTCACGATCCATGATTCTTTCTTCGACAAATCGGACCAGTTGTTAGGAATCTT
CTTTACTTTACTAACTGCAACTAGAGGTAGAACATACGCACACAAGATAGTACACATAGAGATAAAGGATTCGCTATTAT
TGTTAGTTCTTTCACTCTTTACACAAGGAAGAGCACTCTCTTCCCTTACAACACCGAGACACTTCTCAGGTTCTCTCAAT
ACAATCAATTCCTCCCCCTATTCTCCTTCTCCAGAAAGCTGTTATATATTCAAAACTACTAACTAACCTGCCAGCTGGTG
ACAGCTAGCAGAGTCTAACTAACTCCCAACAACCTAACTGTCACTCCTTCTCCTCTTATTCTTCCTACTGTACCGTAGCA
ACTAGCTTAGCTACAGTAGATGATTCTTCTTGCCAAACAGAAATAGATGGGAAAAGGTGTATGCTAGAAAATATCCTTGG
AAGAGTTAGAGAGCTGTCAGTTTGTTAGGACAACTAGGATAACTAACTGTTAGTTATAACCAATTGTTAGTTAGTTAAGA
GGCTATAAATAGCATTGGGAGGGGTTAGTTAGAGGTTAGACAGAAAACTAGAGATAGTAGGAGGGTGATGAGACCTCGAA
TTCATCAGTGTATGTAACCATTGTGTTGTAGCATTTAACTCGAATAAAAATGATTTTTCCTCTATTTTGGTCCAGTTCTA
TCA





USDA Logo
Iowa State University Logo