SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   RLG_Gmr52_Gm9-5
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr52
Description   INTACT
Chromosome   Gm09
Start Position   32949210
End Position   32956932
Sequence   TGATGTGATCTTTATTAGGGGTGGATCGCTTGATACAATTCACAGAATCGAATGATGCCACTTCCAGAGATGGAAGATAA
GCTAAGGGTAGACGCCACAAGGGTTCAACCTTGATAAGTCCGGAATTGGTTCGACAAAGAACCCAAAGAGAAGCTCTCAC
GAATACAAAGGTATTTTTTGAAAAAATGCCAAAAAATTCTTCTTCCTTCAAATGAGTTGAATACATATAGTGTAACATTA
AATTACTAAATTAACTGAAATTGGTGCAATTGAAAAGGCATAGGATTCAGCCACCAATTTATTTAATTACAATTACAAAT
AAAAAAATATTGGATATGGACTTCAAATTAGTTTGGGGCCTTCAACAATCAAGATTCTTGGGAATGCCTTCGTCTTTCTC
CACTTGGGCTTTGTCAAGTATGACTGCTACCATTTGTTGGAGGGTATCCTCTGACTGTTTGGTCCTACCCCTGGTCATAG
GTCCCTGTATTTGGGTAGCTTTGGGATTCTCATCATTCCATCCTTCTTGGAAAGCATTTTCCCTCAAATCTTCATAATCA
CCACCTGCAATAAATGGAGTCAAGTCAGCAACATTAAAAGAGGAACTTACTCCATACTCACCTAGAAGATCGATCTTGTA
AGCATTGTCACTGATCCTCTCTAGTACTTGGAAAGGTTCATCTCCTCTAGGTTGAAGTTTGGACTTCCTTTGTTCAGGGA
ACATCTCCTTCCTCATGTGTACCCAAACCCAATCACCTGGTTCTAGTACTACTTTCTTCCTGCTCTTGTTGGCTTACTTG
GCATAGCTTTCATTCTTCTTTGCAAGTTGAGCCTTCACTTGCTCATGCAATCTTTTCACATATTTAGCTTTAGCCTGTGC
ATCCTTATGCTTAAAATCAGACATGTTAGGCAATGGTAACAATTCAAGAGGAGTCAAGGGGTTAAAACCATACACTACTT
CAAATGGAAAGTGTTGTGTAGTGCCATGTATGGCCATATTGTATGAAAATTCAACTTGAGGCATACATTCTTCCCAACTC
ATTATATTCTTTTTAATCACAGTTCTAAGAAGAGAAGACAAAGTTTTGTTTACTACCTCAGTTTAGCCATCGATTTGAGG
ATGGTACGTGGTGGAAAAGAAAAGCTTTGTTCCAACCTTATCCCATAATGTTTTCCAAAAGTGACTGAGGAACTTGGTGT
CTCGGTCCGAAACAATGCTTCTTGGTAGTCCGTGGAGACGCACCACTTCCTTGAAAAATAATTTAGCAACATGACACGCA
TCATCATTTTTGTTACATGGTATGAAATATGCCATTTTTGAAAACCTGTCAACCACAAAAAAAATGGAGTCTTTACCATT
CCTCTTCTGAGGCAAACCTAAAATCAAATGCATAGATAAATCAGTCCAAGGATATTCAAGAACAGGCAAAGAAGAATAAA
CACCATGAGGCATGACTCTAGACTTTGACTGCTTAGCTTACAAACAATGCACTGTTCACAAAACTTATGCACATTATGTT
TCATATGTGGCCAATAGAAATGCTCCTGTAACATGTCTAAAGTCTTTTGAACCCCAAAATGCCCCATTAATCCCTCCTCA
TGGGCTTCTTTCACAAGTAATCTTCTTATGGATCCTTTATGCACACATAATCTTTTTTCTTTGAACAAATAGTCATTATG
CCAAAAGAAACCATTTTGAACAGTATGTACACATGTAGAATATTTAGAAGCAAAATCTAGATCATGGTTATACAATTCTT
TAATGTGCTCAAACCCAATGAATTTAGTTTCAAGAGTAGAGAATAAAACATACCTTCTTGAAAGTACATCAGCAACTACT
TTGGACTTACCTTTCTTGTGCTTGATCACATATTGGAATTGTTCATGAAACTCCACCCACCTGCCATGTCTCTTGCTTAG
TTTGCTTTGTCCCTTAAGATGCTTCAAGGATTCATGGTCACTATGTATGATAAATTGTTTGGGTAGAAGGTAATGTTGCC
AAGTTTGTAATGTCCTTACCAACGCATACAACTCCTTGTCATATGTGGAATAATTAAGGACAACCTCATTCAATTTTTCA
CTAAAGTAGGCAATGGGATATCCCTCTTGCATTAAAACAACCCTTATCCCAACCCCAGACGCATCACACTCAATTTCAAA
GGATTTTCCAAAATCAGGTAATGCAAGAATTGGCACATGCGTCAATTTTTGTTTAAGTGCAGCGAATGCATGTTCTTGTT
TTTCCCCCATTTAAATCCTACATTTTTCTTGGAAATCTCAGTAAGAGGTGCTACCACGGTACTAAAGTCCCTAACAAATA
TCCTGTAGAAACTTGTCAAACCATGAAAGCTTCTTACCTCACCAACAGTTTTGGGGGTTGCCCATTCTTGAATGGCTTTC
ACTTTTTCTTGATCAACCTGTACTCCCTGTGAGCTAACAACAAAACCAAGAAAAACTACATGGTCCAAGCAGAACACACA
TTTATCTATGTTAGCATACAAGCTCTCACGCCTAAGGGCTTCTAACACTCTCCTCAAATGCCCAAGATGTTCATCATGGA
ATTTGTTGTAAATCAAGATATCATCAAAATAAACCACAACAAATTTTCCTAGAAATTCTCTTAACACATGGTTCATTAAT
CTCATGAAGGTGCTAGGAGCATTGGTCAATCCAAAGGGCATAACCAACCACTCATAAAGTCCATATTTAGTTTTGAAGCT
ACTTTCCATTCATCCCCATCTTTAATCCTAATTTGATGATACCTACTTTTCAAATCAATTTTAGAGAAAACACAAGCTCC
ATACAATTCATCCAACTTATTGTCTAGCCTACGAATGGGATGCCTATACTTTACTGTGATGTTTTTGATGGCTTTGCAGT
TTGTGCACATCCTCCAAGTTTTGTCTTTCTTTGGCACTAGAATAACTAGAATGACACACGAACTCAAGCTTTCTTGCACC
CACCCCTTTTGCTTGAGGTCTTGCACTTGCTTCTGAATCAACTCAATCTCTTGTGGATTGCTCTTGTAACTGGCCAGTTA
GGCAATGAAGCTCCTGGAAGGAGGTCAATTTGATGTTCTATACCTGTTAAAGGTGGCAGTCCATGAGGAATATCCCTGGG
AAAGACATCTTTAAATTCCTGCAATAGGAGCTCAACACTAGGAGAAACAGAAATAGTAAACTCATTAGAATTATCAGTAG
AAATTTTATTGTCTTTCCGGTATAGTAGATAGAGTGGCTAACGAGCAAGTAGCACCTTCGTCACTTCACTCACCTTTGCT
AAACAATTAAATTTTCCCTCAGGTGTTTTACTCTTTCTCTCATGTGTATCACTCTTCTTTTTCTTATTCCTCTTTGGTGC
TTCACTCTTCTCTTTCTCTTGTTCTCTCTTGTTCTCTCATTTTGATTTGGTCATCACACACTTCTCTAGGGGATAGAGGT
TTAAGAATAATTTTATGGTCATAGTGCTAGAAAGAAATCTTGTTGGTGAAGCCATCATATACTGCTTTGGTGTCATACTA
CCATGGTCTTCCTAACAGTATATGAGTCACCTCCATTGGAACCACGTCACACAACACCATATCATTGTATCTTCCAATGG
TGAGACACACCACAACCTGTTGAGTCACTTTTACCTCTTCATCTTCACTAAGCCACTAAAGTCAGTATGGCCTAGGATAG
GGTTTAGTTTCCAGATTCAATTTGGACACTAACCTGAAACTTGGAACATTGGTACAACTTCGTCCTTCAACAATTAAAGA
GCAAAGCTTACCATTAATGGCACACCTGGTGTGGAAAATATTTTCTCTTTGGGTGTCATCCAGTGGCTGCATCTGACTTC
CCAACAGCCTTATCACCATTAGCATATCACCCTACATAGCTTCCTCCTCAAGCTCTTCTTCCACTTCTTCTTCTTCTTCA
TCGATTTTAAATTCACTAATGATTTCTCCATCTCCCTTCACGATCATGGTCCTCCTAGTTGGACATTCAGAAGCAATATG
TCCTCTACCTAAGCATTTGAAGCATTTTATGTTTCTGGTCCCAGTGTTTGACGAGGCAAAGTTATGTTTGGTTCCAGTGC
TAGACGTTGTTGATGGACTGGATGAGTTTCCTCCCTGCTTCTTGGATTTGTTGGTCCAATTCTGGTTGTAAGTATTGGAC
GAGTTCCTTCTTACTTCACTTTTCCTCCTGAGCTATTGTTCGACCCGTACTGCCTTATGTAACAAGTCATCCAATTCCAC
ATACTTTTGTAATTCAACAACATCTCTAATGTCAGGATTTAGACCATTCAGAAAACGAGCCATTGTGTCCTCAATTTCCT
CTTCAATATTGGCCCTCACTAGTGTCATCTCCATCTCTTTGTAGTACTCCTCCATAATCAAACTTCCTTAGGACAGCCTC
TAGAGTTTATGTCGCATGGTTCTCCTGTAGCTATTTGGCACATACCTCTTTCGCATAACCCTTTTCATCTCAGTCCGTGC
ATCTATCTCTCTCCCTTCCTCTCTCAGCATTTCTCTTTGATTTTTATTCCACCAAACAAGGGCATAGTTTGAGAATTCAA
CTACTGCTAACTTGACTTTCTATTCTTCAGATAGTCACTGCAGGAGAATACATGCTCAATTTTCATCTCCCAGTCCAGGT
AGGTGTCTGGATTACTCTTGTCTTTGAAGGGAGGTACATTGAGTTTTACTCCCTTAATTTTATTTTGCCTCAGTCCATCA
TTGCCCCCTCTGTTCCCTCCATTAGGTCGTCCAACATTTTGATTTAGTTGGTTCTCGAGTCCTTCTATTCGTCCATAGAG
CTCTTCATTATTACGATTCAACAAATGTTGCATTTGTGTAGTCATCACGTCCAGTAACAAACGCCGAGCTTCGTCCAATT
AATGATATTCACCACCACCGCCACCAGCTCCTGCCATAATTAAGGAATAGAAAAAAAAGTTTGCAGTAAAATAAATAAAG
GTTTCAGGACCTCACCACACTTTACTTACGTGTTTCTCTCTTTGATAGTAGTACACTTGTGTTTGATGCTCTCAAAATAG
GCTTTTGTGTGATGTTTTCACTCTTGCCTTTTACCACTTTTGTCCCCTCTTAAGTTCCTGGATGGACCAAATTGGACGCA
CAAGGATTGAACGCACCAAGAAGTGATGCTTCAAGGCTTCGTCCAAGGTAGCATAATAGGAAAGATAACTTAAATATCAC
ACAGACTCAATAATAGACAACTTAAGTCATAAACAGAAGCCAAAAGACATAGACAGCACAAAAGAGGTAGAATTGAAACA
AAGAAACTACTCAATTAAAAGAGAAGAAGAACAAAAATAGTGAAAATGACACATAAAATTCCAATTATCATAACTTTTGC
TATGGTCGTCTATTTGAGGCCCATTATATATCAAAATTCTCAGAATTGAAATGAGAATCCCTGGGCAAATCCACGTTCAA
AGATCAAACATCCAACTTTTCAAACTTTCTACAACTGCTTTCTTTTTTTATATATATATTATGTGTTAAATCATAATAAA
TGACACATAAAATTCTCATAATTCTTCCAGGATAATAGAATGTTCAATCAATTCCACTGGTCCAGCCAATGTATTTGTTC
AATAGGCAATTAGGAAATTTGACCCAAATCCTAAATTCATTCAGCAAACAAAATTTGTCTAGACCAATGTACACATCTAG
CAAGCACAAACAGATCATCCAACAAGCAGACAGAGAAACGAAATCGAATAGAATAGATAGAAAATGAAAACAAAAATAAA
ATCAAATAGCTCATCATTGGAAAACGAAAATAGGCATATATCAATTCAGAAACAGAATTGTGAATTGTAAACACAAAAGT
GGATGAAACCAAAAACAACAGGGAAAGAAGATGAACATATGGAAAAGAAGATGAACAGAAAAAAATCACAAACGAAAAAG
AAAAAACAACAAGAACTCAAATTATAGAACAAAACACGAACAGAGAATGAGACATCAAAATACGAAGGAAAAAAATGAAG
GATAGGATAGACCCTGTATCATGAGTCGAAGCTCTGATACCAAATTATATGATCCTTATTAGGGGCAGATCGCTTGATAC
AGGTCACAGAATCAGATGACACCACTTCCAGAGATGGAAGATAAGTCAGGGGTAGATGCTACACGGGTTCAACCTTGATA
AGTCCGGAATTGGTTTAACAATGAACTCAGAGAGAAGCTCTCACGAATACACAGGGTATTTTCTGGAAAAATGCCAAAAA
GTCCCCTTCCTTCAAATGAGTTGAATACATATAGTGTAGCATTAAATTACTAAATTAACTGAAATTGGTGCAGTTGAAAA
GGCATAGGATTCAACCACCAATTTATTTAATTACAATTACAAATAGAAAATATTGGACATGGACCTTCAAATTAGTTTGG
GGCCTTCAACAATCAAGATTCTTGAGAGTGCCTCTAGGCCTTCGTCCTTCTTTACTTGGGCCTTGTCAAGTATGGCTGCT
ACCATTTGTTGGAGGGTATCCTCTGACTGTTTGGTCCTACCCCTGGTCATAGGTCCCTGTATTTGGGTAACTTTGGGATT
CTCATCA





USDA Logo
Iowa State University Logo