SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr368_Gm14-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr368
Description   INTACT
Chromosome   Gm14
Start Position   13551959
End Position   13557113
Sequence   TGTTAGAGCCTTAGCGTGTACTAGGCTTCGAGGAGCCAGAACCTCCAGAACAAAAGGAAGAAAGGAGGAAAGAGGTAATA
ATTTCTTTCATTCATGCCCCTCCTTATTACAAATGATTAGTATTTATAGTGGTATAGTTCTAACATAATTTGTAATTCTG
TGATACATGGTCCTAACGGAATTTGGAATTGGAGGGCTAAGTGGCAGACAAGGATTGCAATTGGCTGACAAGATTGCCAG
CTCAGCACTAAATCTGTTAAACGAAATCTTTTAAGTATGCATGGGAAATGCTTTGTCTCGTTGGTCTTGCTCTGGTTAAT
GCTTGTGTATTCTGATGTGCTTGTGTATTCTGCTGGTTACTATCATTTCCGAGTACCTCCGAAAGCACCTTGTCCTCAAG
GTGGTAAGCAACTTTCAATTGATCCCAATCTTCCCATGACGTGTCATCCGGAGATAGGTCCGTCCACTGAACCAGAACCT
ATAATTTGGAAGCTGGGGAATTGGACTTGCGACGAGTGCTGACAATGGCTAAAGGAGTAATAAGGGGTTGATGGTCAATG
AAAGTCGTGGGTAATGCCAATGGGGGAATGGAGCTACTTGAAGAATGAAAGGGTTTCAGCATAAAGACATGGAACACGGG
ATGAATTCGAGCGCTTTTAGGTAGTCACAGTTTGTAAACTGCTTTGCCATACTGAGCTATTATCGGAAAGGGCCTATAGA
ATCTTTTAGTTAACTTCGTTGAGCCCAGGTGGTGTCCAGAAATCAAGCTTTGACGATGTGGTCGCAGTTTGACCATTACC
AGATCGCCAATCTGGAAGTGAATATCCCTCCTTTTGTTATCAGCATATTGTTCCATAACTTGTGGGGCCTTTAACAGCTT
GTGTTGGACTTGCTTAAAAACAGCGTCCCGATTAGTCAACAGGTCATCGACGACATCCACATTGGAAGTTCCAGTAAGAT
ATTGAGGAAAGGTAATGGGCTTCTTGCCAAAGGTAATCTCGTAGGGAGAAATACCAGTCCTGGAGTGGTGTGATGTATTA
TAAGACCATTCAACCCAACTGAGAAATTTCCCCCATGTTGTTGGCTTCTTATGAACAAAGCTACGCAAACACTATTCAAC
GATGCGATTAAGTACCTCTGACTTCCTGTCTGTCTGCGGGTGATAAGTAGAACTCATTCGCAGACGGATACCACTGAGGC
GGAATAGCTCTCGCCAGAAACGGCTAATGAATAAAGGGTCGTGATCTGAAACCAAACTCCGAGGCATTCCATGGAGTTTT
CTGACGATGTTAATGAACAGAACTGCCACCGAGAGGGACGTGTGGTGTGTGGGTAACATACCCAAGTGAATGCCCTTTGA
AAAGTGCCACTACCAGAATGACAATGTTGTCGCAAAACGGTGGTAAGCCAGTGATGAAATCGAGGGAGAGGTCTTCCCAT
GGTCGGCATGGTACCGTTAACGGACATAGCAACCTGGCAACTCGCTTGGTTTCATATTTTGTATGCTGACAATCGATACA
CGCCACCACAAAGTCCGCCACATCTTTCCGTAGTCTCGGCCAGTCAAAATTCTTCGTCAGCCTTGCCAAAGTCTTAGCTA
CCCCCATATGTCCCCCCATGGGTGTCAAATGATACTCTGTAAGCAACATGGGAATGATTGTGGATCCTTGTGGTAGCCAA
ATACGACCCCATTTGAGGATGAAGTCATTCACAACAGTGCAATCAGGGTAGTTATCCGGGTTAGCAACAATATTCTGCCG
GAATTCGATGAAAATAGGGTCATCGGATAATTTCTTCTTAAGCTCTTCTAAGAATATCAGGCAAGGAATAGAGAGCAACA
ACATGGTACTTGTAGTGGGATCAGGGAGTCTCGATAAGGCATTCGCGGCTAAGTTATGCTTTTTGGCCCGATACTAAATG
TGGTAATCATAACCGAGGAGTATGGCCAAGTAAGTCTGCTGCTTCGGTGTTTGGACCACCTGCGTCATCAATTCTTTAAG
ACTGTGGTGATCAGTTAGAATGACAAAGGGATGGCCCAAGAGATATTGGTGCCACTTCTTGACGGCAGTAGTGATTGCAC
AGAGTTCCCTGACATATGTAAAAGCTCATAGAACCTTAGGACTAAATAGCTTACTGAAAAAGGTGATGGGATGTCCATTT
TGTGATAAGACCGCACCCATGCCCACTTCAGACACGTTCGTCTCCAGGGTAAATGGCAGGGAAAAATTTGGTAGCAATAA
AACAGGGGCCATGGTCAGAGCTTCTTTTAGCATATCAAAAGCTTGTTGAGCAGTGAGGGACCAAACAAATGAGTCTTTGG
TCATCAAGTGATTCAATGGGGCCGCAATTGAAGCGTATCCGCGGATGAAGCATTGATAGAATCCAGCGAGGCCCAAAAAG
CTGCGTAGCGCTCGGGTAGACAGCGGAATGGGCCATTGTTGAATAGCCTGGATTTTGGACCCAATTGGTTCGACGCCCCT
CGAAGACACCACATGGCCCAAATATTCAACTTGATTTTGAGCAGACAAACACTTTGACATTTTCAAAGCAAATTGCTCGT
CCAAAAGAATCCAGAGTGCCTTCTCCAAATGAATCACATGTTCATCCAAAGTACAACTGTAAATCTAGATATCATCAAAG
AAGATGATGATAAATTGATGGAGGTGTGGCCTAAAGATGGCATTCATGGTAGCCTGAAAAGAAGAGGGAGCATTGCTCAG
TCCGAAGGGCATCACTTTGAATTCATAGTGGCCCTGGTGCGTGCGAAAGGCAGTTTTACCAATATCCTGTTCATGCATGC
GAATTTAATGATAGCCCTGAAGAAGGTCCAATTTGGAGAACTAGCTAGCGCCACCAAGTTCATCCAGAAGTTCATCAATG
GTGGGAATAGGAAAGCAATACTTGATGGTAATGGCTTTTAAAGTGCGATAATCAATACAGAATCACTAGGTGCCATCATT
CTTTTTGACCAAAAGGACCAGAGAAGAGAAAGGGCTATTACTTGGGCGAATGAGGCCCTTGTGTAGCATCGAATTGACCT
GAGCTTCAATTTCATTTTTCTAGAAATAGGGATATCGGTAAGGGAGGACATTGACAAGTTCGGAGTTAGGGAGGAGATGT
ATATGGTGGTTAGTCGGTCTTGATGGTGGTAGGGATTGGGGTGGTTGGAACAAAGACTGGTATTTTGTGAGGATGTGGGA
AATCGCGGGAGGAGGTTGGGTAAATAGTTTCTGGTCTAATGGAGGTTCTATGGGGATGATCGAAATATGGAAGTAAGCAT
TGGCACTCTTTGTGCGAATTATACGATGAAGTTGGGGTGGGGAAAGCAGGTGGAAAGTGGAGTCAATGTCACCCTGACAA
CAAGACGACCTTCATAGAAGAACTTCATGGATAAAGTGTTGTAATCATTGAGCACCGGTCCCAAAGTTTTAAGCCACTAG
ATGCCTAAGACCATATTGGCACCGTATAATGGTAAGAGATGAAGATCTACTAAGAACGTGATGTTCTGGATGACTACAGA
GACTGATTCACAAAGGTGGTGGTAGTGGAGAAATTGACCATTGCCCACCATGACTTTGAGAGGTGCAATGGCCCGAGAAG
CCAAGCCCAATTGTTGTGCCAATGATTCTTGTATAAAGTTGTGGGTACTCCGCCCATCAACTAGAATCAACACCTGTTGT
TGCCCGATAGAACCCAATAAGCGCAGTGTCTCAGGGGCTAAGTGGCCCGAAAGAGAATGAAAACTTATCTGGGCTTGGTC
TAGGTCAGGCGGGTTAGGCAGGTCGGGTGGAGGGTCTATATGAATGAGGTCTGCTGGAGGGTCCATTTCTTCATCATTCG
TGATGAGAAGGAAAACCCTAGAGGCACATTTGTGGTCGCGGTGGTACTTCTCATTGCAGTTAAAGCACAAATCGCACTCG
CGACGAGAAGCTAAATCCTTGGGTGACAGCGTTTGAGGGGTATCGGGGTCTGGAGTTTCGGAAGGCTAGGCAACAAGGGG
GGTGGCAGAGTCAAGGGGGCAGGCGAAGCAAAAGAGGGAGTAGTGGGGGTGGTGCGGCCACGCCAGGCTCACCGATGATC
GAGGAATTTTTCCTCCTGAAGGCGAGCTAAGCCTGCCGCTTGCGCCAACATCAATGGCTGAAGAGCCTGGACCTCCCGTC
GTATGTTCAGAGACAAACCAGAAATGAAGCAGCTCAGGAGGAAATGTAAGGGAAGTCCAACAATTCTATTAGCGAGGTCT
TCAAAATCAGAGAGGTAATTATTAACAGTGTCGCGCTGAGTAAGCTTGAACAGGGCCCCCGTGGGATCCTCATACTGAGA
GGGTGCAAAACGCATTTGGAGGGCTTGGATGAAGGACGATCATGACGTGAATTGGCCGTTGCTGGTCATCCACTGGAACC
AGGCCAGAGCACGACCATCCATGTAGAAGGAAGCGATGGTCAGGTGTTCGTGCTCCAGAGTCGAGTGGTACTAAAAAAAT
TGCTGAATCTTGAAGATCCAACCAATGGGGTCCGTGCCTACAAAGTGAGGAACGTCCAGTTTCAGGCGGTGTACTGCGGA
AGGTGACACCGGAGGGGGAAAAGTAGATGAGGAAGAGGGTGAGTGAGTGGTTCGGTCTGGTTTCTGAAGATGGTTGATAA
GCTCGTCAAGTTTGTGGGTCATGTGCTGGAGGGTATCACTCAGGGAAAGCTGATGGGTGGTGAGCTTGGTGATGGCGTCC
TCAAGCCTATTGGAATTGGCTCTAGAACGTATGGATTCGGCCATGGAAACAATCAATGAGAGCACCAAATTGTTAGAGCC
TTAGAGTGTACTGGACTTCGAGGGGCCAAAACCTCCATAACAAAAGGAAGAAAGGAGGAAAAAGGTAATAATTTCTTTCA
TTCATGCCCCTCCTTATTACAAATGATTAGTATTTATAGTGGTATTGGTCTAACAAAATTTGTAATTTTGTGATACATGA
TCCTAACGGAATTTGGAATTGGAGGGCTAAGTGGCAGACAAGGATTGCAATTGGCCAACAAGATTGCCAGCTCAACACTA
AATCTGTTAAACGAAATCTTTCAAGTATGCAGGGGAAATGCTTTGTCTCCTTGGTCTTGCTCTGGTTAATGCTTGTGTAT
TCTGCTGTGCTTGTGTATTCTGCTGGTTACTATCA





USDA Logo
Iowa State University Logo