SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr359_Gm6-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr359
Description   INTACT
Chromosome   Gm06
Start Position   47934027
End Position   47935559
Sequence   TGATAGCACCAGCAGCAAAGAGAACAAGGAAGACATCTCACGTAAAGTTGCATGCATGGCCATTAGTTAGTTAGCAAGGT
TGTTAGTTAGTTACAAGTTGTTAGTTAGTTAGGCTTTTCAACTGTTAGAGAGTTAGTTGCAGGATATGTAGCAATGTAAA
CTCCATTATATAAAAGGATACTGCGTGCATGAATAAGAGAGTAGAGAAAAGTCATTTCCAAAGTAAAAGCTTAGTGTAGT
TAGGAGGGACTTTGCCCTCGAATCAAGGATATCTCTATCTTCTCCTCTGGCTCATAACAATTGGTCCGACCTGCCGGATC
TACGAAGCTTTCATGGCTGTCTTCCATAGCTGCCACTCGTCAAACAAAGCATCCATGGCTGTCGAGGACTGCCTTGAGGC
TGCCTTGGCCAACCTTGCCACCGCTCAACGCCGCCTCGAATCCTCATTGGATGCCTTTCTCCTAAGATTGCCTCGGCGAT
CCGACCACCACTACCCTTCTTCCTCCCTGCAATCACCATCGTCGCTGCCCCCGCCGTTCAAGCCAACTCTGTCACCCACG
CTTACCACACCCATGACCATGCCAACTCCGCCGCTGCCCCCGCCGCTCACGACAGTTTCATCCTCCTCCGCACAACCACC
ACCACCAACAGCACCCACGTCAGTTCCTTCCTCCTCTGCACAACCCCCACCAACAACAGCACCCACATCAGCTCCGCCTC
CCTTGGATGTTTTCCACCATCCCAAACTCAAAACAGTCGCACCCATAGCTCTGTTGTCGCCTCCCCGCTTTCATTCGACC
AACCGCCACATCCGACTCAGTCGTCTGTTGCCTCTATCACTCCGCATCGCCCACCGTCGTTACCTTCACTGCCCTTGCCA
CAAAATCCCTCATGGCAATGACACCATCTTGCTCGGTGATGATGCCGTAAAGCATCATATTCTATCCGCACTTGGTTTGG
ATTCTTTTCATCGTCAAGACTTGGCTTTGCTCCGTCTGTCATCGGCGACGACGTTTGCCGCCACACCCGCCACCATATCC
ACCACCACCACTGAAGCCATCACATCCAAAATACACCCTCACCATGTTCCACGACTCCATGTTACGACCTCACCATTCTT
TGTCTTAGTGCAATGGGTGGGTCTTGCGCCAGAAGAGTCCACTTGGGAGAAGTGGGACGATTTTTGTCACTCCTATCACC
TTGTGGACAAGGTGATTTTCCCAGGGTGGGATAATGATAGCACCAGCAGCAGAGAGAACAAGGAAGACATCTCACGTAAA
GTTGCATGCATGGCCATTAATTAGTTAGCAAGGTTGTTAGTTAGTTGCAAGCTATTAGTTAGTTAGGCTTTTCAACTGTT
AGAGAGTTAGTTGCAGGATATGTAGCAACGTAAACTCCATTGTATAAAAGGATACTGCGTGCATGAATAAGAGAGTAGAG
AAAAGTCATTTACAAAGTAAAAGCTTAGTGTAGTTAGGAGGGACCTTGCCCTCGAATCAAGGATATCTCTATCTTCTTCT
CTCGCTCATAACA





USDA Logo
Iowa State University Logo