SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr27_Gm9-7
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr27
Description   INTACT
Chromosome   Gm09
Start Position   45293898
End Position   45295770
Sequence   TGTTAGGAACCAAGAATTGAAATGAGGAAGAAAATAAAAGATTTTATTGACTAGTAAGAAAAGAACAGAAAATAGGAGAG
AAAACTCTCCTCCAAGGGTTTCCCCTTCACAAAAGATTTCTCCTTTCACAAAGCGCTAATGCTCAATCTACAAATGATAA
GATCCCCTTCTCTCCTATCCTTCTTCCTTTATTTATATCTAATAAACCCCTCTAACTAACTAACTAACTCATTATTATTT
TAACTATATTAACTAACGCTTCTTTCTCCTAATATCCCAACAATACACCCCTCCTAAAATCAACCTTGTCCTCAAGGTTG
GAATCTGAAAACTGGAATTGCACACTGAAACTTCCTAAAATTTTGTCTGATTGTTGGAAGACAACTGCACCCTTGTAGCT
TAACTAGGAACGACACACTACCCCTGCATGCAAACTGAGGTCCGGTGGCTTCGGTGGTGGGAGGGACAAGGGTGGACTCC
ATATAACTTTAATCAGCTTGATTGGCTCAGTACATTCCGTTTGCCTTAGCTCCATGGCTAAGCTGTCAGCCATAGATGCA
ACAAAATTTAATGCTAAAGGCACACCCAACAAGTTGACATTCCAAGATTTCAGCACCATTGTTGTTCCAACCACCTTCAT
GAATGATTTTTGTTTCACCATAACAATCTTTTTATGGAAATCTGAATCTTGAAAATAATGTGACTTGGTTGAATCACCAG
CTTCGACTTCCTTCTTGATCATATCTGTAATTGGGTTATCAAGAAAATCGTCTTCGCAGCCCACATTCGTCACTCCGTTT
TCCTTGTGCTTCTCCCTCTTTATCGGTGGATCAACTTCTTCCTCCATAACCTTTTCAATCTTTTTTTTCTCCTGCTAACT
TTGCTTCATCATTTTTGGTTTCTTCTCCACCACAAAGGGTATGGTTCTTGATTACTGAACCTTCTTTACTTGTGTTTTTT
TATTTCAAGAACTGCAATGGGTCATTGTCACACTCAAAACTCAAATCAGTTCCCCCTTCTATGTTTCTATCAAAGTTGGG
TAGTTCCTCCTTTCTTGCCCAAGAACTAGCCTTTGCTTCACTGAATTCTGACCCACTTCCCTCCATGCTATTTTTGTCTT
GTTGAGAGGCATGGGAATCAACTTTTTCATTCAATATCTTGCGCAACATGTGTTTCCGCTTTGAAATGTCGGTCCTCCCT
TTCAAGAACTTTGTGGAAGTCTCCCATTTTTTGATGTGGGTTTTTGTCTTAGTTGGCTTTTCTTGCTTCAAGATACTCAA
TCTTTCAAAGATGTGGTTACCATGGCGATCTCCGAATCTTTTGATCAAAGCTGTGAAAAATGACTCCCAATCTGAATCTG
GATTGTTTTGGCTCCAAATGTAGAACCAATGTGTCGCAGCACCCTCCATGCTCATGAATGCATATTGTAGCTTATGGAAC
GAAGGAATTTCTTGTACCTCAGAATTTTTCAGCCCTAGCAATCCAACCAATTGGGTCTGTCCCCATGAACACTGGCAGCT
CCACCTTCTTAGCCCAAATTTGTGCTTCCTCCATCTCTAACACTGGCTTCCCCTTGAAGTTCCGGCAGGTCAGACCAATT
TGTTAGGAACCAAGAATTGAAATGAGGAAGAAAATAAAAAATTTTATTGACTAGTAAGAAAAAAACAGAAAATAGGAGAA
AAAACTCCAAGGGTTTCCCCTTCACAAAGGATTTCTCCTTTCACAAAGAGCTAATGCTCAATCTACAAATGATAAGATCC
CCCTCTCTCCTATCCTTCTTCCTCTATTTGTATCTAATAAACCCCTCTAACTAACTAACTCATTAGTAGTTTAACTATAT
TAACTAACTCTTCCTTCTCCTTATATCCTAACA





USDA Logo
Iowa State University Logo