SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   RLG_Gmr240_Gm4-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr240
Description   SOLO
Chromosome   Gm04
Start Position   28591259
End Position   28591665
Sequence   TGTTATGAACTGAAAATCAGCTCAATGTTTCCTAGCATTCGAGGTCTAGGACCCTCCCAAGAAGAAAGAAAGAGAAGAAG
GAAACTCTAATATTTTTCTCTGCTACCTTCATCACGATACATCATTCATTCTTATAGGCACTGCAGCTACTGGATAGAGA
CAAAAGGTTCTAACAAGAATGGCACTACCAGTGGAATAACAGAAAAGGAATAATAAGGAGCAAATTATAACAGAAATATG
TAAGTGGCAGACAACCACTAATTCTATAGCCACTGAGAAGCTGCCAACTCAACACTGTTGTTGGAATTGGTTACGCAGAA
TCATTTAGAGATATTGTGGCTTGGTTATCTTCATCTTGGGCCTTTGGTTTGTGTATCTGCTACTGCTGCTTTATTCCATT
CATAACA





USDA Logo
Iowa State University Logo