SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr206_Gm4-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr206
Description   INTACT
Chromosome   Gm04
Start Position   48672592
End Position   48675326
Sequence   TGATAGGAAGAAGGTATTACAGAAGGAAGAAGGAAGAAACAGGCCTGCTAAGGCCCAAAAGGAAAACAGAATCGAGGCTG
AGTTGGCAATGAGACCTTGTTGTGTAGTGTTACTAGGAGACAAGTTTAACCGCTTTTTGTTATTGTAATATTTCCTAGCG
TGATTTGGTGCAATTCTGTTAGCAAGAAGAATTGCTATATATATGGCTATGTAATAATTAGCAAGGATATGAATGAAAAT
ACAGAACTATTCCCTCTAGCTTTCTTCTTTTCTTCTTCTTCTTCAGGAGGTGTTGGCCCTCGAAGCCAGTTATGCAAGCT
TAACGTATCATTTTGGTGCTTTCTGGGGCTTGCTGGGTTTTACCGCCGTTTCATCCGTGGTTACACTTCAATCGCAGCAC
CTCTGGTCCACCTCACCACATTGGACCACTTTGAATGGACACCCCAAGCACAAACGACTTTTGACCAGCTTAAGCACGCT
CTCTTCGAAGCTCCCGTTTTAGCCTTGTCGGACTTTCAGTTTCCTTTCACCATTGATAAAAACGCCTCTAGTGTTGGGAT
GAGGGCAATCTTGTCACAATGCAACCACCCCATCGCCTTCTTTAGCAAGCCTTTCAGTCCAAAATTCCAACGAGCATTAG
CGTATGTTCATGAACTATTTGCGATAACGGCGACGGTAAAGAAATGGCACCAGTACTTGCTTGGCCATCGTTTCACTATC
ATCACCGATCACCGCAGTCTCAAGGAACTCTTGACTCAGGTCATACAGAAGCTGGAACAACATATGTATCTTGCGCGGTT
GATGGGTTATGACTACCAAATCCAATACCATTTTGGCGTACACAACCAAGCGGCAGATGCTCTCTCCAGATGTTTTGATC
ATGACTCGTCCACACTGATGAGTCTATCCGTTCCTTGCCCATTGTTCTTCGAGGAACTACGTCGCCAGCTAGATGATCAT
TCTGAGTATCGACGACTTAGAGAAGCCATCACGACATAACCAACTAAACACTCGGGTTTCACCCTGGTTTATAACTTGAT
TCTCAGAAGGGGACGAATTTGGCTACCGAAAGGGCTATCCTTGATTCCCACATTACTTATTGAGTATCATTCAACACCTG
CCGGCGGTCACATGGGAATCGCAAAAACAATAGCCCGTTTGTTGGAAAACTTTGATTGGCCAGGACTCCGGGAAAATGTC
ACCAATTTTGTCTCGCAATGCATTGACTGTCAGTTCCCCATCGTCCCTGGAAAGACTTATCCCTTGACTTTATCATTGGA
CTTCCGCCCTATCACGGCAACACAGTGATATTGGTGGTAGTTGATTGATTTTCAAAGGGAATCCACCTTGGCATGCTTCC
ACCAACTCACACATCTCATGCAGTAGTCTTCTTGTTCATGGAAATTATGGGAAAGCTTCACGGTCTCCCTCGTAGCCTGG
TCTCTGATTGCGATCCTCTATTCATTAGCAAATTTAGTAGGAGTTGTTTCGTCAAAGTGGCACGCAACTGAGGATGAGCT
CAGCCTATCACCCACAAAGTGATGGTCAAACAGAAGCTTTAAACAGAGTCATAGAGCAATATCTATGAGCATTTGTGCAT
CATCGGCCAAGGGAATGGGGCAAACTCCTTCTATGGGTAAAGTGGTCTCATAACACATCATGGAACACGGCGACGGGCAC
CACACCCTATGAAATTACATTCGGCCGCAAACCATTTAATTTCCCAGAATATCTCATGGGCTCCTCCACTCTTGATGCGG
CTGATGATATGCTAACAAACAGAGAAGACATGTTCTAGGTCATTCGCAAGAAGCTTTTGAAGGTACAAGAACGTATGAAG
ACCATTGCGAATGCGAAACCGAGAGAAGTGACCTACCAACCAGATGACTGGGTCATGCTTAAACTACGTCCGCACCGGCA
AGCTTCAGCTAAGGGACCACACGCATTCATGGGAAAATTAGTTAAGCGATTCTACGATCCATTTCAAGTCCTGGAACGCA
TAGGGACCATAGCATACTGCCTGAATTTACCAGAAGGGGTTCGCATACACCCTGTTTTCCATTGTTCATTGTTGAAAGCA
TTCAAAGGATCTCCGGAATCCATCCAAGAGGTTCACTTGCCGAATCAATTTGTTCAACATTAGCCCGTAATTACTCCTCT
AGCCATATTAGATTATCGGCGAACATCGGCACAAGGACCTTGGGAAGTGCTCGTGCAATGGGAAGGGTTATCCCCAGATG
ATACTTCCTGGGAAGACTGGACTCAATTATGTGAAGACTATCACCTTGAGGACAAGGTGATTTTCCAAAAAAAATGCAAC
AACTAGAGGTGCCAATGCAAAAATCAAAGGTGCGGATAGAAGGAAAAGCTAAGAGGGCCATCACAAAGCCCTCTTATAGT
GATAGGAAGAAGGTATTGCAGAAGGAAGAAACAAGTCTGCTAAGGCCTAAAAGGAAAACAGAATCGAGGCTAAGCTGGAA
GTGGGACCTTGTTGTGTAGTGCTACTAGGAGACAAGTTTAACCGCTTTCTGTTATTGTAATATTCCCTAGCATGATTTGG
TGCAATTATGTTAGCAAGAATTGCTATATATATGGCTATGTAATAATCAACAAGGATATGAATGAAAATACAAAACTATT
CCCTCTAGCTATCTTCTTCTTTTTCTTCTTCTTCTTTTTCTTCTTCTGGAGGAGGTGTTGGCCCTCGAAGCCAGTTGTGC
AAGCTTAACATATCA





USDA Logo
Iowa State University Logo