SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr19_Scaffold70-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr19/diaspora
Description   INTACT
Chromosome   unanchored
Unanchored Scaffold   70
Start Position   18490
End Position   29882
Sequence   TGATCGAGGCCGTACCCGAATCAAATAAACATTAAAAATGTAGTATCTAGGAGGTGATCCTAGGTCGTCTCCCAACGAGC
AATGGTCAACCAAACGTTCATAACATATTGTAATAAAACAGTAACGAATTAGGGGGGTTGTTTGTTTTGTAAATTAAATA
GCAAGTAAATTTTAATTATAAAATATCAGAATTAAAACACATTGTTTCCCTTTGATTCACAAGCAAGTCTCTTATCCTAG
GTTACGAGGATTTATCCTTTATCAGTTCAACCACTTAATCCAACCCTAAATTAAATTACTAAGCGAAATTTAACATAAGG
CATTCATTATGTGATTAAGCAACACATACACCAATTAATCATGAACGAAACTGATCATTAAGCATGAACGTAAATTAAGC
GTAGAGACAATTAATCAAGCATTAAGCATGCATGGATTAATAGCAACAAATACAGAGTAATTGGTGAAGAGGAAAAACTG
ATCAGAATTCAATAGTAATAATAAAACCTCAAAGAGAGTTGTGCTTGATCCTCAAGAGAAAACAACGCTGGAGACTTAGC
CTTCCATTAATCAATAGAAAACGAAATTGTAGTAGAAAACGAAGAAAACTAGAATTATTCTCCAAAATGAAAAAGCTAAA
ATGAAAGAGAGAGAGAGAGAGAGAGAGCCTAAAACTAGAACCTTGGTGCTGTTATATAGTTCTCAGCCCCAAAGCTTACA
AATCTTTTTTAAGTCCAAGCCTATAAATAAAATAAAATCTAGATAAGATAAGACAAAATCTAGATGAAATAAAATTTAAA
TAAGATCTAGATAAAATAATATCTAGATGAGATAAAATTTAGATATGATAAGATTTGGTAGAATAAAATTGTCTGTTCTC
TTCAAGTCCAAGCCCAATTCCGGATTCAAGCCCAATTACTTATAATTCTCCTGAAATTTAATTAAAAACACAAAATTAAT
CCAGTAGGCCCAAATGATAAAACTGCATAATTAATTTGACAATTAAGGCTAATCAGTAATTAAAATGGTGACAAAAAGGG
TTAAGAAATATGAGAAAATGATGACACATCAAATCCCCTCACACTTAGCCTTTTGCACTCTTGGGAAAAATAAAAAAAAC
AAAGCAAGGGACAAATTCAAAGACATTAAAGAGAAACAAACAAACACAACAACAATTACATGTTTCTCAAGGAATGAAAA
GAATGGGTAACATGCAACACGTAAAGAGTTAAAGAGTCAAGGCCGTCATGAAGATCATCTAAGCATCTCATACATGACAA
GATAGTAAATCAGCTCAAGAATGAAAAGTGATAAAGCCTTACAAGATATGCACTCTATCTCTCAAGTGTCTAGGCTACTG
TTTACTCTCAGAGCACCCATGAAAACAAACACCACATAGACTTGGCAAGACTCTAAAATTGACAACCACATCACAAGCAC
ATGCACATGAGGATCAAAAGGTCTTTTAAGGTTGTAATGGGGCTAAGGACAAGGTAGATGAAAGTATGGGATGGTAGCTA
AAACCCAAAGAAATAGAGGAGCAATGGGGAATAAGTGGAAAGTAAGAAAAAGTAATAAACCCCAAAACAAAAATTACAAA
TTAAGCTCTAAAAAGTAACCCAAAACAAAATCAACCAAGTCCTCAAATCAATTCAAGTCTTCAAACCAAGACCTCAATTA
TTCAACCTCATTCATTTTTTATTTATTTTTTTGAACGTGAACCGTAGTAATTGAAAACATTTGAAAAATAAAGCAACAAT
TAGGCAATATATGTATATACATCAAGCATGACCAACAAAAACATATCATCCAATGAAACATACCCCCCCCCCCTTCACAC
TTATTCCCAAAACAATTCCAAAGCTCCAAAATTCTATCATGGTTTTTCACTTAACGCATGTAATGAGCTTCAAAACAAAG
AAAGGGGAACATAGGCTCAAAGGGGCTATCAAAGGAATTAATTCAAGGTAGGCTCATTTGGCTAGAGGCTTATAAGAACA
AAATGCCTAAATCATCTCCCAACATGCATGTGAAGCAAGAAGTATCAATAAGAGTAAGCCAAGGCTATTGTGCAAGCAAT
CAATGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCCACCATGAAGTCTTTCTTAGCTATCAAGCTGTCATGGAACTTCTTGGTCTTCTCCTTGTAGAATT
TGGAATTCTCATAGGCTTCTAAACGGATCTCATCTAGCTCACTTAGTTGCAACTTCCTTTCCTCTCTAGCTTGATCAATG
GAGAAGTTGCAGGTCTTTACAACCCAGTAGGCTTTGTGCTCTATCTCTACAGGAAGATGACATGCCTTGCCAAAGACAAC
CCGATAAGGAGACATTCCTATAGGTGCTTTTTAGGCAGTCCTATGCGCTCAAAGAGCATCATCCAGCCTGGTGCTCCAAT
CCTTCCTTTTCGGCTGCACAATCTTCTCCAAGATCCTTTTTATCTCCCTATTTGAAATCTCAGGCTGCCCATTAGTTTGG
GGGTGGTAAGGTGTGGAAATTCTGTGCACGACCCCATACTTTTTGAACAAGGCATACATGGATCTGTTACAAAAATGGGT
GCCTTGATCACTAACGATGGCTCTAGGGACTCCAAACCTGCAAAACATATTAGATCTAACAAAATCTACAACAACCTTAG
CATCGTTAGTTCTGGTGGGTTTGTCTTCCACCCATTTTGAAACATAATCAACAGCAAGGAGAATATAAACAAAACCAAAA
GAGATAGGGAAAGGCCCCATAAAATCTATACCCCAGACATCAAACACCTCACAGAATAACATGGGTTGTTGAGGCATTTG
CTATCTCCATGAAGGTGAGTCGCCTGCTCTCTAACAAGGCTCACAAGTGCTACAGATTCTCCATGCATCCTTAAAGATGG
TGGGCCAATAGAAACCACAGTCAAGCACCTTGCGAGTTGTCCTTTGTATGCCAAGATGGCCACATGGTGCAGAAGAATGA
TAGAATTGCAAGACCGAGTCAATCTCATGGTCTGGAATGCATCTCCTAATAACTTGGTCACTGCACAACTTCCACAAATA
GGGGTCATCCCAAATATAATGCTTAGCATCGCTTTTAATTTTATCATTTTGTGCTTTAGATGCTAAGGGAGGAAAAACAG
AAGCAACCAAATAATTCACAATATTAGCAAACCAGGGAGTGGGGAAGGAATCAGAAATACTATACAGAATGTACAAATGG
TCATCCGAAAAATCATCCCGAATGGGTGTGTCCTTAGACACATGCTCAATCCTACTCAGATGGTCAGCCACGAGGTTCTG
CGCACCACTCCGATCACAGATCTCTAAATCAAACTCTTGGAGCCAAAGCATCCACCTGATCAATCTAGGCTTTGATTCAG
CCTTCTTCAACAGGTACTTCAGAGCTGCATGGTCAGTATAAACAATAACACGAGTACCAAGTAAATATGAACGGAATTTC
TCAAGAGCAAAAACTATCGCTAATAGCTCATTCTCTGTGGTAGTGTAATTTGCTTGAGTAGCATCCAAAGTTCTGGAAGC
GTAGTAGATCACCCGAGGTAGCTTATCAATCTTTTGAGCAAGGACAACCCCCAATGCGTAATTGGATGCATTGCACATTA
GCTCGAATGGGGCTATCCAATCAAGTTCCTGAATGATAGGGGTGGTAGTCACCGCACGCTTGAGGCAATCAAAAGCCTCT
TTGCATCGGTCATCAAAATCAAACTTCACCTCCTTTTGCAGCAGATTGGATAGTGGAAGGGCCACTTTGCTAAAATCCTT
GATAAAGCGCCTATAAAACCCTGCATGACCAAGAAAAGAACGAACCTCTCGCACGCAAGAGGGGTAAGGCAATTGTGAAA
TAACATCTATTTTTGCAGGGTTTACCTCTATGCCCCTACTGGAAATGATATGCCCTAAAACTATACCTTGTTCTACCATG
AAGTGACATTTTTCAAAATTCAACACAAGGTTAGTTTCAATGCATCCATTAAAAACTCTATCCAGACTATCCTAACATGC
ATCAAAAGAGGATCCATAAATAGTAAAATCATCCATAAACACCTCTATGCAATGCAACTCTCTAAAAAATCACTGAAAAT
GCTAAGCATACACCGCTGGAAGGTACCAGGGGCATTGCATAGGCCAAAGGGCATCCTCCTATAGGCAAAAGTGCCAAAGG
GATAGGTGAATGTGGTCTTTTCTTGATCCTTGGGAGCAATATAAATTTGTAAATAACCAGAAAAACCATCAAGAAAAAAG
TAATGAGACTTACCTGCCAAGCGCTCAAGCATTTGATCAATGAAAGGCAGGGGAAAATGATCTTTTCTGGTTACCTGATT
CAGCCTCCTATAATCAATGCAGACTCGCCAGCTGTTTTGCACTCTTGTGGGAATAAGCTCATCCTTTTCATTCTTGATCA
CTGTGAGGCCTGTCTTCTTAGGAACTACTTGGACTGGGCTCACCCATTGGCTATCAAAAATGGGATAGATGATTCCAGCT
TGTAAGAGCTTGGTCACTTCCTTTTTCACCACATCTAGAATGACGGGGTTAAGTTGCCGTTGTGGCTGCCTCACTGGCTT
AGCTCCATCCTCTAAAATTATCCTATGCATGCAGGTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATGTTAAAATGAACAACAATACCTACCTCTCTCG
AGACAATGTGCCAGCATAAACATCTAACTTGGTTCGGGTTGTTTTCATAAATGGCCTGCCTAAAATAATTCGAACTGAAC
CATGGGAAAATCCCTCTTCCATATTAAGAACATAAATATCAACAGGAAAAATAAGATCACCAACCCGAACCAGCACATCC
TCTATGAAACCTACGGGGTAAGCAACACTTCTATTTTCCAAATGAATCACCACATCTGTAGATTGCAAGGGTCCAAGAGA
TAAAGAATTGAAAATGGACAAAGGCATAACACTAACTGATGCTCCTAGATCTAGCATGGCATTCTCAAATTTACTGTTCC
CAATAATGCAAGGTATACAAAAAGTACCTGGGTCCTTACATTTCTCAGGAATGTGAGGAACAGATTTACCTATCAATGCT
GACACGTTTCTGCCTATGCTAATCCTCTCATTGCCTTTGAGCTTCCTTTTGTGGGTGCACAACTCCTTTAGAAACTTGGC
ATATCTTGGAATTTGCTTGATGACATCTAGCAGAGGTATGTTCACCTCTACTTTCCTGAAGGTCTCCAAGATCTCCTTTT
CCGCTTCTTCCATCTTTTTGTTTGGAATTGCTCTAGGTGGGAATGGAAGAGGGATAAGAGGTTGTGGTAAGTCAGAATTA
CTAGAAGAAGGTTCACCTGCATGAAAATTTTTGTTAGGAAGCTTTCTCCTTTGTGCAACTATCTCATCCTCTTTTTCAGG
TGTAGAATGAAGCTTGACAGATTCAGGTGCAGGTGCTGCTACTGGTGGAGACACTTGAATTTGGTTGCTAGACCTCAAGG
TGATGGCACTCACATTTTTCGGATTCTGCAAAGTTTGTGAAGGAAATTTGTCAGAATTTTGGGACTGAGCTTGGTTCAAC
TGAGTAGCCATCTGCCCCATCTGATTTGTCAGACTCTGAATGGAGGCTTTTGTCTCTTGCTGAAATTGCATATTCTGGAT
GGTCATTTGCCTCACTAACTCTTCTAAGGAAGGTTGAGGAGGAGCCTCAGTTTCTTGTTGTCTTTGTTGTGACTGTTGCT
GCTGTATTGGAGGAGGAACATATGGCTTGCTTGGACCAGCAACATTCTGGAAAGGAGGGACAGGTCGTTGTTGTTGTGGA
GGACTTTTCCATCTCAGATTTGGATGATTCCTCCAACCTGGATTGTATCTATTGCTTGAAAGGTCATAATTATTCTGCTG
TTGTTGATTTTGCTGTTGAGGAGGTCTATTATAAATGTTTGCAGCATAAGCTTCAGGTTGCTCATTGACTCCAGATTGCT
GCAAAGAAGGACAGAGATCTATATGGTGATCTGCAAAAGAACATAGGCCATAGACTCTTGCAACAGGTGTAGATTTCTGA
TTCATTGCAAGCTGGGTTACTAGGTTGACCAAGGCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATATCAAAATAAGCTGAAATTTTGGTGAGGGAACACCC
TAAAAATATGAAAAGATAGCACAAAAAATTTCAAACAAAAATTCAAAGTCTAACTATGAAACTACTTAGCAAAGTTAGAA
AAATAGGACAATAATACTTGAAAAATAAAAAAAACTTAGTAAATGGCTGATTTTTGGAGTTTGGGAGACCCCAACCGGCT
TTAGCCAATTGTCACAATATGGGAAATTTTTTTCTACCCCAAATGCATATATAATAATAGTTATTCTGATACCCGGAGCA
AAAGTTATGGTCATTTTAAGTTTTGCTAAAAACAAGTTCCCAGAGTTTTTGTCTCTCTCAAATACTGCCACACTAAGTGC
TCCTGTTATTTTTCACACAAAATATGGATCAAAAGAAGCTACCACACAAAAATTCAGCCAAAAATAACAACTCTAACTAT
CAAAACAAAAATCATTAATTAAATTGCAAAATTCGTCGTTAATTCCCAATTGCTAATCACTGTTCAGCACTGTTCACAGC
AAAACAAAAGGCTGAAACAGTCGCTAAACAGGGAATGCAACTGAAATGCAAAACAGAACGCTACACAAAATAAGATAACT
AAACACTATTATGAACCTTTGGCCCACTGCTCCCCGGCAACGGCGCCAAATTTGATCGAGGCCGTACCCGAATCAAATAA
ACATTAAAAATGCAGTATCTAGGAAGTGATCCTAGGTCGTCTCCCAATGAGCAATGGTCAACCAAACGTTCATAACAGAT
TGTAATAAAACAGTAACGAATTAGGGGGGTTGTTTGTTTTGTAAATTAAACAGCAAGTAAATTTTAATTATAAAATATCA
GAATTAAAACACATTGTTTCCCCTTGATTCACAAGCAAGTTTCTTATCCTAGGTTACGAGGATTTATCCTTTATCAGTTC
AACCACTTAATCCAACCCTAAATTAAATTACTAAGCGAATTTTAACATCAGGCATTCATTATGTGATTAAGCAACACATA
AACCAATTAATCATGAACAAAACTAATCATTAGGCATGAATGTAAATTAAGCACAAAGACAATTAATCAAGCACTAAGCA
TGCATAGATTAATAGCAAGAAATACATAGTAATTGGTGAAGAGGAAAAACTGATCAGAATTCAATAGTAATAATAAAACC
TCAAAGAGAGTTGTGCTTGATCCTCAAGAGAAAACAACGCTGGAGACTTAGCCTTCCATTAATCAATAGAAAACGAAATT
GTAGTAGAAAACGAAGAAAACTAGAATTATTCTCCAAAACGAAAAAAGCTAAAACAAAAGAGAGAGAGAGAGAGAGAGAG
AGAGCCTAAAACTAGAACCTTGGTGCTGTTATATAGTTCTCAGCCCCAAAGCTTACAAATCTGTTTTAAGTCCAAGCCCA
TAAATAAAATAACATCTAGATAAGATAAGACAAAATCTAGATGAAATAATATCTAGATGAAATAAAATCTAGATAAGATA
AGATAAGATAAGATCTAGATAAAATAATATCTAGATGAGATAAAATCTAGATATGATAAGATTTGGTAGAATAAAATTGT
CTGTTCTCTTCAAGTGCAAGCCCAATTCCGGATTCAAGCCCAATTACTTATAATTCTCCTAAAATTAAATTAAAAACACA
AAATTAATCCAGTAGGCCCAAATGATAAAACTGCATAATTAATTTGACAATTAAGGTTAATCAGTAATTAAAATGGTGAC
AAAAAGGGTTAAGAAATATGAGAAAATGATGACACATCA





USDA Logo
Iowa State University Logo