SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr183_Gm9-2
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr183
Description   SOLO
Chromosome   Gm09
Start Position   40416289
End Position   40416941
Sequence   TGATAGAAACCTTAGTAAGGAAGTGGGCCTTGATGAGAATGTTAATAGGCCCAAGGTTTGGAGAGTGTATACGAGGAAGA
AGGGAAAAGGGAAAAAGAATGATGAGGTGGCAGAGGATACATCAAAATAGTACTATATAAGTAGTAGTATTGAGCAGTAG
TGGGGAGGAAAGAATTCTGTTATTTGGTAGGGTCACTGAATCAGTGATTTGGGATCTGGTAGTACACTATCAGATTATTA
TCTTTTATTCCTTCAGCTGTTGAGATCGTAATTGTCCTACCATAATACAATTCCACTATTTCATCCATTTCTTCCCACTG
TTTTTATCTGTTATTTACTGTTTCATTCATCTTTCTCATACTTAATTTCACCAATTGGTCCGATTACAATCTCAACAGCT
GAAGGAATAAAAGATAATAATCTGATAGTGTACTACCAGATCCCAAATCACTGATTCAGTGACCCTACCAAATAACAGAA
TTCTTTCTCCCCACTACTGCTCAATACTACTACTTATATAGTACTATTTTGATGTATCCTCTGCCACCTCATCATTCTTT
TTCCCTTTTCCCTTCTTCCTCGTATACACTCTCCAAACCTTGGGCCTATTAACATTCTCATCAAGGCCCACTTCCTTACT
AAGGTTTCTATCA





USDA Logo
Iowa State University Logo