SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLG_Gmr148_Scaffold146-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Gypsy
Family   Gmr148
Description   SOLO
Chromosome   unanchored
Unanchored Scaffold   146
Start Position   26216
End Position   26618
Sequence   TGATACAGCTAGAAGAAGAAGTTCTGGTTTCGAGGACCAAGGCCTCCGAGAGAAGAATTAAGATAAGAAAATGCTCATTT
CATTCATGCTTTTGTATATCGTATTACACTTATTTATACTAATTCAATTAACAGAATTGCTACCCTTTTGGAATATTCAG
GATCAAGTTTGTTAGCATTGTCTCCCACGTGCATGAATGGCTCTAACAAAATTCCTATAGTGCCTATCCCACCCCCTCAG
ATATAATCTCTAAGGTATGCTGGCTTTGCTACTCTCCTTTTGGGCTTTTGCTCTTTGTTGGACTTCTTTGCTTGTTGCAC
CTCATCATGTTCATTGCTTGCCTGCCTCTGCTATGTGTTGTCCTGTGTTACTACCTGCCTCTGTTATCTTCTTCCCTGTA
TCA





USDA Logo
Iowa State University Logo