SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLC_Gmr465_Gm11-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr465
Description   INTACT
Chromosome   Gm11
Start Position   11953755
End Position   11958331
Sequence   TGAAAAACTTTGTATTCTCCTGTGCAGAATTTTGCATTAAATAGTGCTCATACAATTTGATTTTTACATCTGTGCATTAA
ATAACCAATCTGCAATAAATGCTATCCTACAGCTGGGATAACTAATTAAGGAGATAATTACAGCTGTATAATCATGTAAG
GTTTATTGTTTTGAATGACCAACAAATCTGTGTCAATAATAACAAATATTTTGCAATTTGTGCCAATTAATAACTAATAT
CTGCTAATCAATTTCATTGACATCCCCCCTCAAATTAATGCTGGTAAGTCTAAAAGCATTAATTTGCTGACTAGGAAATT
ATGGCATTGACGTGTCAAGGATTTTGTGAGAATCTCAGCGAGTTGAACAGATGTAGAAACATGAGGCAAGGTGATAACTC
GATGGTCATACGCGTCTCGGATTGAGTGACAATCAACCTCTATGTGCTTCGTTCTTTCATGGTAAACAAGATTTGTGGCA
ATTTGAATGGCACTTGTATTGTTAGCATGCAGTGGAGTTCGTTTTGCTTGTGAAAAATCAAGCTTTGAAAGGAGACCATG
TAGCCAAATAATCTCAGAGCATGCAACAGACATGGCGTGATATTTTACTTCAGTGGGTGCTATAATACGGTGTACTGGTG
AAAGATACAAATGCCGAGGAAATTGTATGAATCTGCTTATCGTGTGGACAACTAATGAGATATGTTGTCTGGTGATGGTT
AAGTAAATAAGACTTCCAACTAGCTTACAATAGAAAGTTGGGTCTTGTAGAAGGTCACCTTCATCTCGTCACAATTTCAG
ATTAATTTCCATTGGAGTGTCAACAAGAGCAGAATTAGTGAGACCAACTAATCGAATTAGATCTTGAATATATTTGTGCT
GATTGACAAAAATGCCTTTCTGTTGAAAGTGTACTTCTAATCTCAAGAAATAAGTGAGTTAGCCAAGGTCTTTCATGTGG
AAAGTTGAATGCAAAAGTCTCTTGATCGTACAAATAGCCTCTTGATCTAATCCGGTGACCACAATATTGTCCATATAAAC
CAGAAGTATGACAATTCCTTTTAAGCTCCTTTGAATGAAAATGACGGATCATACCTGCTTTGTATGAAGGAAAAACCAAG
CAGTGTTGTGTGAAACTTTTCAAACCATATACTTGGTGCTTGTTTCAATCCATATAAAGAACACTTCAGTTTGTTAACAG
CATTAGGCAAAGGTGAAGGCATACCGGTAGAAAGTTTGATGTAAATTTTCTCTTTGAGGTCACTATGGAGGAATGCGTTT
TTAACATCCATTTGGTGTATTTGCCAAGATTCAGATGCAGTAATGGCAAGAATAGTGCGCATAGTAGTCATTTTGACCAC
AGGTGCAAAGGTCTCCTCATAATTAAGGCCAAATTCTTGATCATTTCCAAGAACAACCAGCCTGACCTTCTATCGGTTGA
TTGATCCATTCAAATGAACCTTTATATTGAATACAAATTTGATGCCAAGGGGTTTGACAGAAGAAGGACAAGTTACAACA
TCCCATGTCTGATTTTCTTCTAGTGCTTGTAGTTTTGTTTCAATAGCTTCTCTCTAGCATTTCTGCTCCGTGGCCTGTCT
ATAAGAAGGAATAGGAACAAATGCTATAGTTGCTGTCAATGATAAAGGGGAAGAAAAATCATACATTTCTGGTGGTTTAC
TAACGCGAGTATTGCGATGTAAAGGAGTTGGTGCTGGATGAAGCATCGGATCAGCAGCTAGAGATTGATCGGGAGGGGGC
CTTGGAGGTATGGATGGTGGATTTGGTGGAACAGCCTGACGTCTTTGATACACCAATAAAGGTTGCGGTGCTGATTTTCC
TACAGAATTGTTAGGAAACAATAGCAAAACAGAAGTGGATGTAGAAGAGGGAGTGTCTTGGTTAGTTGGAAAAAAATGTA
TCTTCTTGAAAGATGACATTTCTACTTTTCTAGAAACTCGAAGCCTATGTAGATTAGGATTATAACACACAAGTCCTTTA
TGGTGGGCAAAATAACCAAGAAAAACTCATTTAACAAATTGAGCTATGAGCTTGGTGTGTTCTTGTGGGGGAAGGTGGAC
ATAACAAGTATAACCAAAAGTGCGTAGGTTGGAATAAATGGGTTTGTGACCATATAACTTGAAGAAAGGAGAATCATTGT
TTAATGATTAAGCAGACATAATAAGGCGGACAGCAGTGGAGAGAGTCTCACACCAAAATCGAGGTGGCACAAAAGATTCC
AACAAAAGGGTACATGGACATCATCAATAAGATGACGATTTTTCCTTTTAGCTACCCCATTCTATTGGGGTGTGGAAGGA
CATGACCTTTGAGGTAAAATGCCATTTGTCTGCAAGAAATAAATGATATGTATATTCCCCCCCCCCGGTTGTCGGAATGC
AAAATTTTAATCTTGAAAGAAAATTGGGTCCGAACATAGGCATGAAATTTTTTGAAAACAGAGAATGCTTCATCTTTGGA
GCGCAAAAAATAGACCCAAGTGAAACGACTATAGTCATCAATTAAAGTGATAAAGTATTTGTAATTATCATGGGATATAA
CCATTGCAATCCCTTATAGATCACTATGAGTCATATCAAAAGGCTGATTTATCTTTTGATTTATGAATTGGAAATGGTAG
AATTTTACTTTTCCCAAGTTTGCAAGAGTTGCAATCAAATTGAACAACACTAAGAGATGGGAAAATTTGATTACCAAGAA
CACCAGATTTCAGTAAGTCATGAAGTACATAGGAGTTTGGGTGACCAAGGCGCTTATGCCATATTTGAAAATTAACAATA
GTTAAATTACAAGAATCCAAAGGGGGAAAAGAACATTGAGGCTGAGATAAATAAAGAGGAAAAAGACGTTCGACTTTAGG
CCCCTTCGTGATCATCTTCCCTGATCGTTGGCCCTACACAAGACAACCAGATTTTGAGAATGTAAATTTGCAATCATTGT
CAACTAGTTGACCAACAAAAATAAGATTACTAGTGAGATCAAGGGAAACAAAACAATTGGTTAAAGAGGAGGAAATGTCA
CCAATAGCTGTGATTGGTAGACTGTTTCCATCAGTAGTATGAATTTGAAGGTTACTAGAATATCTTGTGACATTTTTAAG
GGATTCAGCACTGTTGGTCATGTGATTGGATGCACCGGAGTCAAAATACCACGAAGTACAAGAAGAAAAAGGTTTTCCTG
AAAGTCCTAAAGTAGAAAATGCAGAAATTATCATTTGTTGGACCATTTCAGGGGTCATTGGTTGCGTAGAGGCAAAGCAT
GTTGATTTGCAGAACCACCAGCAGTAGAAGGACCAGCTGCAACAGTAAAGGCTGTTTCAGTTTTCCTTGGTGGTCTTATG
GGGCATTCTTTAATGATATGGCTGTCTTTTTTGCAGTAATTGCAAAACTTTTTAGGACAGTGTGAAGCAAAATGTCCAAG
TTCTTTGCAACAGAAGGTTTGGACATCACTCAGGTCTCAACGTTTAGGTTTTCCTTGTGCAGCATATGCAACTGGAAAAA
AGCGAGATTTTTGTTGTTCCATGGATGCTTGAGTTAGGAGACGTTGTTCTTCATGAAGAAGCTCATTGAGACATGTATCC
AAGGATGGGATAGGAGCTCTATTCATGAGATTGGACCGAATACCCTCAAAGTCAAATATCAATTTCATAAGAAATTGATC
TCTTTTTGTAGTCTCATGAACTTTTTGCACTGCAATTTGACTTTCATTTGACAAATGTTCATAGACAATGTCAGTGTATT
CAACCTAACGATTCATGAACTGAGAATAAAATTCAGAAATTGAGAGACTATCTTGTTGAAATATGGCAATTTCATGTTCC
AGCTGGAACCTTCTAGCAATATTATTCTGGCTATAAATCTTCTTGAGATAAGCCCACATCTTGCCATTGGTCGGAGATTG
AGAACAATATGAGGATCAACAGAGCCTATGATCCATGCCATGACATGGGCGTCCTTGACTTCCCACACAGTATATTCGTT
CAGCTGGTTTTCTTTGTTAGGAGCAGAATTGGTGCCGTCAACATGACCTCCAAGGTTCTTACCTTTGACAAATATCTGAA
ACTGGAATGCCCAGATAGAATGGTTCTTTCCATTAAAGGCAAATGAATAAGACATCATACTTGTCACTAGACATATGGCT
AAGGGAAAAAAAAAGGTAATCACAAGGGAGAAATCACAAAAGGAACAAGGAGCAAGAACTGGATAGTCTTGCAAAACCAA
GAGGCTAGGAATTTTGAACGGAACTATGATAGGATTGCAACCTAGACTAATATCATATTAGGCCAAGAAAGTTATGAAAA
ACTGTGTCTTCTCCTGTGGAGAATTTTGCATTAAATAGTGCTCATACAATTTGATTTCTACATGTGTGCATTAAATAGCC
AATTTGCAATAAATGCTATCCTACAGCTGGGATAACTAATTAAGGAGATAATTACAGCTGTATAATCATGTAATATCTGT
TGTTTTGAATGACCAACAAATCTGTGTCAATAATAACAAATATTCTGCAATTTGTGCCAATTAATAACTAATATTCTGCT
AATCAATTCCATTGACA





USDA Logo
Iowa State University Logo