SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   RLC_Gmr38_Gm9-8
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr38
Description   INTACT
Chromosome   Gm09
Start Position   32679556
End Position   32684356
Sequence   TGTTATGGAAGTGATGAAGAACAAGCAAGAACAACAGCAGAAAATGCAGTAGACCAGAAATGTCATACACACCGAATTGT
GCAGCAAAGGTGAAAGAGAGAAGCATGAGAAAGAACACACATAGGATTACGTGGTTCACCTTGAGAAAGGCTACATCCAC
GGGAGGGAAAAACAGAAAGCTTTTATTATAGTTGCAGTATACAAGTGGAAGCTTATTCTATCTTTGAAATACAGGACATC
CTTGCCTTATATAGGCAGAGGACAAAACAAAAAAAAATAACAGAATAAACTTCCTTATGGATTTAGGTCACAGCCCAACA
ATTCACCACCTTGAACTAACATCCATATAGGACACAAACTGCTCCCTCCAAACACTCATGATCTTATCCCCAGCAGTCAA
CATTGAGCAAGCTTAAGCAGTGATCAAACTTGCTCTTTAGAACTGGCTTTGTGAACATATCAGTAGGATTGTGCAGAGTG
CTGATCTTATGAACTTTGATTCTTCTTTCTGACCGAATGAAGTGATATCTAACATCTATATGCTTGGTTCTATCATGATG
AACCTGATCCTTGGCCAAGCATATAGCACTAAGGCTGTCATAGTAGATGTTACCATATTCTTGATTAATTCCAAGATCAT
TTATCAGACCTCTCAGCCAAATTCCTTCTTTTGCAGCTTCAGTAAGAGCCATATATTCAGCCTCGGTAGTTGAGAGGGCA
ACAGAAGGTTGAAGTGTTGCCTTCCAACTCACCAAGCAGCCACCAAGGGTGTAAGCATACCCTGTTAATGACCTTCTCTT
GACAAGATTAGCAGCAAAACATGCACCAGAATAGCCAGTAAGGCAGCAATCTGAGTGAGATCCATAGATCAAACCTACAT
CTGCAGTCCCTTTTTGATATCTGAGAAATTCTCTTTACAACTTTCCAATGTTCCTTCTGAGGTTGGTTTAAGAACCTACT
AACCATGCTAACAGCATAAGAAAGGTCAGGTCTGGTGCAAACCATGGCATACATGAGACTGCCAACAACACATGATTATG
GAACCTTTGACATGTAGTCCTGATCAGCTTGAGCTTGAACCTTTATCACAGTAGACAACTTCTCTTTTTCTGAAAGGGGA
GTGCTGATAGGTTTAGAATCAGCCATTCCAAACCTCACAAGTATCTTCTGAATGTAATCCTTTTGAGACAAAAATAGCCT
TTTCTGAGTTCTGTCCCTATAGATTTCCATTCCTAAGATTTTCTTCACATCCCCTAGATCTTTCATATCAAATTCACCAT
TCAGGAGAATCTTCAGATTTTGTATATCACACATGTTTTTTGCTGCAATAAGCATGTCATCTACATAGAGTAGAAGATAA
ATCATTGATTCATCCTCCACCTTGTTGTGATAAACACAGCAGTTGGCTGGTGATAAAGCTGTCAAACCTCATGTACCATT
GCCTTGGAGATTGTTTCAACCTATACAAGGACCTCTGTAGTTGACAAACATACCTTTCTTTTCCTTGAACTTCAAAACCT
TCAAGTTGTTTCATTAGAATATTTTCTTCCAATCTTCCATGGAGAAAAGCAGTCTTGACATCAAGTTGTTCAAGTTCCAG
ATCTTGGTTTGCCACTATAGCAAGCAGAACCCTGATGGATGTATGTCTGACCACAGGAGAAAAAATTTCATTGAAATCTA
TTCCTTCTTTCTGGCTAAATCCCTTGGCAACTAACCTAGCCTTGCATCTTATCCCTTCCTTTTCTGAAAGACCAGGTTTT
CTCTTGAATATCCACTTGCAACCTACCACATGTCTTCCTTTAGGTAGTTCAACAAGTTTCCAGGTCTGATTCTTATATAA
AGATTCCATTTCCTCTTTCATAGCTAACAACCAATTTTCAGCTTCAGGATGATTGATAGCTTCTTGGTAAGTGGCTGGTT
CATTTGAATCTATTTCTTCAGCTGCATGTAATGCATAGGCAGCCATGTCTTCAAAACCATATCTTTCAGGAGGTTTAGTG
ACCCTTTTTGGTCTCTGATTGATTTCAGAATTAAGCTGTGGAGGACCAGGTTCAGCGGCCAAATGAGACTCATTTGCACT
GAAATCTTCTAATTTCTCACCTTCTTGAAAAACCATAGGAGATGTTTCGGAATGACCCCCCTTTTCTGAGTCTTTGGCTG
TAGATTCTACATCCTTTTCTTGAGGAGAGTGGCAGCTCTGTGTTCCAGCAATTGGAACCTCAAGCTTGGGATGAAACAGA
TGTGATTCATCAAAAATTACATCTCTGCTGAGTAGAACTTTCTTTTCGGATGGAGACCAGATCCTATAGCCTTTCACCCC
ATCACCATAACTCATGAACAAACCCTTTCTTGATCTAGGTACCAGCTTTCCTTCATTGACATGATAATAAGCATTGCAGC
CAAATACTCTTAGGTTTAAGTAGTTTGTTGTTTTGCCATTCCAGATTTCAATAGGAGTTTTAAGTCCTATAGCAGTAGAG
GGTGTTCTATTGATCAGAAAATAGGTTGTATTGATAGCTTCTCCCCAAAAACTTCTGTTGAGACCAGCATTAGACAATAG
ACATCTTGTTCTTTCTAGGAGTGTTCTATTCATTCTTTCAGCAACTCCATTTTGCTAAGAAGTGTTCCTAACAGTAAGTT
GTCTAGCAATCCCTTCATCTCTGTAGAATTTGTTAAATTCTGTTGAGCAAAACTCCAAGCCATTATCAGTTCTGAGTCTT
TTAACTTTCCTTTCAGTTTGTTTTTCAATGCCTTTCATTCTTTGAAGCATTTGAAAGCTTGACTCTTTTGACTCATGTTG
TAGATCCATGTCAACCTTGAGTAGTCATCAATTATGGACAGAAAATACCTTCCACCACCTAGAGAAGGTACTCTTGCAGG
CCCCCATCAATCAACATTAATGTAATCAAGAGTTCCTTTGGTGGTGTGAATTGCTTTAGGAAATTTAATCCTATGTTGTT
TGCCGAAAACACAGTGCTCACAGAATTTCAGTTCATCCAGTTTCTGATTTCCCAATAGCTGCTATTTTTGAAGTATCATC
ATACCTTTTTCACTCATATGACCTAGCCTCATGTGCCACAATTGAGTTAAGTCAGGTATGCTCTTATTGGATCTTGATGC
AACAGCTACTAGACCATCATCAATACATGTTGTACCTTGAAGTATATAGAGATTACCCCTCTTTATACCCTTCATCACCA
TTGTAGAGCCTTTCTAAATTTTCATGACCCCATTTTCAGTGTTGCATTTGAACCCCTTTCATCCATAATACCTATGAAGA
TTAGATTCTTCTTCAGCTCTAGAACATGCCTAACTTTAGTGAGTGTTCGGATAATTCCATCATGCATCTTGATTTTTATT
GTGCCAATTCCAATTGTCTTGCATGAGACATCATTTCCCATGAAGACATTTCCACCCGATTTCTCTTCATAGGTGTCAAA
CCAGGTTTTGTTAGGACACATATGAAAGGAACAGCCAGAGTCTAATATCCACTGATTTTCAGAATGTTGGTGATGATCAA
CAACTAAGAGAACAAGCTCATTTTCAGATGTGGAACCTTCCTTGGCAACAGCAGCAGATGGTTTGCCCTTTTTCTTGGGA
CAATCTTTCTTCCAATGACCTGGCTCCTTGCAGTAGTTACAAATATCGTTTGGATTGACATGAGTCTTCTTCTTTCCTTT
AAACACCTTTTTCTTGATGTTCTTGTTAGAGTTAGAGGCAACAAGACCAGATCCATTTGATTCTTCAGAATTTCCAGGTG
CTTTAGATCGAAGTTCTCTTGAGTATAAGCTGGATTTCTCCTCCTCCATGGTGACACATTCCTTACCAACACTAAGAGAA
TTGACAAAGCTTTCATATGATGGTGGTAGAGAGGCTAACAGAATCATGGCAGCATCTTCATCCTCTATCTTAACATCTAT
ATCTCTTAATTCCTTCAAAATAGAATTCAATTCATCAAGATGATCTTTAAGAGATGTACCTTCTTTCATGTTTAAACCAA
ATAGATGCCTCTTCAAGAAGAGCTCGTTGCAGATTGACTTAGTCATATACAGTTTTTCCAACTTGAGCCATAAGCCACTT
GCAGTTTCTTCATTTGCAACTTCATATAAAACTTCATCAGACAAGGAAAGCATGATTAGTGAGTGAACCTTTTGTTCTTG
TTCTGCAAGTTCTTCAGTCTTTGAAATAGAGGCCTTTTCTTTTTGATTCAGAAGCCACTTCTTTCTTCACAGATGCAGAA
GCAATAACAGCCCAAAAACGTTGTTCCTTCAACAAAGCACGCATCTTGATGCGCCACAGATTGAAGTTGTTCTTTCCATT
GAATTTCTCAATCCTGATTGTGTTTGACATGATTTCTTGAATGTTCTTGATCACAAAGAAGCAGCGAAAGAACCAGAAAC
AAGACTCCCACAGCTTGATCTTCGTATTCAGACGAGAATATTGAATTCCCTTGATCGCAACTAGAGCTCTTGATACCAGT
TTGTTATGGAAGTGATGAAGAACAAGCAAGAACAACAGCAGAAAATGCAGTAGACCACAAATGTCATACACACCGAATTG
TGCAGCAAAGGTGAAAGAGAGAAGAATGAGAAAGAACACACACAGGATTACGTGGTTCACCTTGAGAAAGGCTACATCCA
CGGGAGGGAAAAACAGAAAGCTTTTATTATAGTTGCAGTATACAAGTGGAAGCTTATTCTATCTTTGAAATACAGGACAT
CCTTGCCTTATATAGGCAGAGGACAAAACAAAAAAAAATAACAGAATAAACTTCCTTATGGATTTAGGTCACAGCCCAAC
A





USDA Logo
Iowa State University Logo