SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLC_Gmr31_Gm9-2
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr31
Description   INTACT
Chromosome   Gm09
Start Position   36111951
End Position   36116599
Sequence   TGTTGGAACACACACGGTTCCTCACTCAATTGCAAGAGATGCAATTCACTCCCTCACACATTCACTCGTGTATCACTCAC
TGTTTTCAAGCAAAGAATTGCACACACACTAGGAATAGCACTAGAGACTGAAAATGATAGAATGAAAACAACACTTTATT
AAGATGTATGATTGCCCTTTTATACAAGCAAAACAAAGTAACAACCCTTCACTCTTGGGCTAACACTTATAACATAATTT
TAAAATTCTGTTACTCTCTCTTATATACAAAGCCAAAACAGAATTAAACTCTCACACCCTTCCTTAATTCTGATCTCCTA
AGTCCATCAAGCCAATTCTGTCCCTTAACATTTTAAACCTCTCCCTTTGAGGGGTTTGGTTAAAATATCAGCAAGTTGAT
CAAATGTGCAGCAGTACTCCACTTTCAATTTCTCTTTGTTCACTTGATCCCTAAGATAGTGAAACCTTGTTTCTATGTGT
TTGCTTCTACCATGAGAGGTTGGATTCTTTGACAGGCTTATAGCTGACTTATTATCCACAAAAAGCTTCACTCCATCACT
CTCCTTGATTTTTAATTCCTGTAGTAATGTGTCCAACCAGACAGCTTGACAAGCACTCATTGCAGCTGCAACATACTCAG
CTTCACATGTTGATAGAGCCACTATGGATTGCTTCTTAGAACACCACGATATTGGTGCTGCACCATACATGAATATGTAA
CCTGTAGTACTCTTTCTGTCATCTCTGTCTCCTCCCCAATCTGCATCAGTATATCCCATCAATTCCTCTGAGTTGCTATT
GTCTTTATTTGGAAATAAAATTCTAGCATTGATGGTCCCTTTTATGAACCTTAGAATCCTCTTGGTAGCTAGGAGATGAG
GAATTCTGGGTCCTTTCGTATATCTACTTACCAGTCCAACAACAAATTCCAAATCAGGTTTTGAATGACACAAGTACCTG
AGAGAACCAACAATCTGTTTGAACTCAGTTGCATCGACTTTGTCTTCCTTGCCCTCCTTTTCAAGTACAAGACCTGCCTC
CGTTGGTGTTGCTGCTGAATTACATTCAACCATGTTGAATCTCTTCAATATTTCTGTTGCATACTTACTCTGGTGCATCA
AAATACCTCTCTCAGTCTTCTTGAATTCAAGTCCAAGGAAATAGGATAGAACCCCCATATCAGTCATTTCAAACTCACTC
ATCAATTCCCTTTTCAGTTCTGCTATCTCACTTTCATTACCACCAGTGATCAACAAATCATCCACATAGAGGCATATAAT
AATGATATTACCTACTGATTTGGATCTTACATAGACTCCAAACTCACAGCTACACTTATCAAAGCCAATTTTCATCATAA
AACTGTCAATTTTCTTGTTCCAAGCTCTTGGGGCTTGCTTAAGTCCATAAAGAGCTTTTCTCAACGTGAGAACCTTTGAC
TCTTGGCCAGCTATAGAGAATCCAGGTGGCTGAGTCACATAGACCTCCTCATCAAGAGGACCATTTAAGAAAGCACACTT
CACATCTAGTTGGTGCATTGTCCAATTCTTTAGGCTAGCAATTGCCACTACTGTTCTAATAGTCTCAATTCTAGCAACTG
GTGCAAACACCTCTCTGTAGTCAATCCCAGCTTTCTGTAAAAATCCTCTAGCCACAAGTCTAGCTTTATACTTGACCACC
TTGCCTTCTGGATTTGTCTTAATCTTATAGATCCACTTCACATCAATGGGCTTCTTCGATTTTGGTTGAGATACCAGCTC
CCACACTTGATTTTTCTCAATAGATTTAAGCTCTTCTGTCATAGCTTCAACCCACCTCTGATCAGTCATAGCATCTTCAA
AGTTTATTGGTTCTGCTTCAGAAAACAAAGCAAAATGTACAAGATTCCCATCTGCACTTACATCAGCATCAGACAACATC
TCAAAACATTGAAATCTAGTTGGTTTGGGTGCATTTCTCTAGGGTCTCACTTCTCTTTGAGTGGTATTACCATTCCCTTC
ACTTGTTTCTTCCTCTTCTGACCTTATCATTATTGAAGGTCCCTTCATTTCAGTATTCTGCTCCCAGTTCCAGCTTCTAG
ATTGATCAAATACCACATCCCCACTGATTATTATCTGCTTACTCTTCGGATCAAACAACTTATAGCCTCCAGTTGAGTGA
TATCCGAGTAATATCATTTGTTCACCTTTATCATCTAGCTTCCTTCTTAACTGATCTGGAATATGCCTAAAACAAAGTGA
TCCAAAGATTCTGAAATGACTCACATTTGGTTTAGCACCACTCCAAGCTTCTTCAGGTGTTATTCCTTCCAATCTCTTTG
AAGGGCTCTTATTCAAGATGAAGACAGCTGTAGACACTGCCTCTCCCCACAAGTACTTGGGCAGACTCTTGCCTTTCAAC
ATGCTCCTTACCATATTCATTATGGTTCTGTTTTTTCTTTCTGCAGCTCCATTATGTTGAGGTGTGTAGGGAGGAGTCAC
TTCATGAATTATGCCTTCTTGATTACAAAATTCTTGAAATTCTACAGAAACATATTCACCACCACCATCTGTTTTCAATA
TCTTGATCAATGAGCCACTTTGCTTTTCTGCCATATTTTTGAACTTCTCAAAGACTTCAAAGACATCACTCTTCCTTTTT
ATTAGGTAAACCCATACTTTCCTAGTCAATTCATCAATAAAGGATATGAAGTATCTGTTTCCACCTAGAGATTCAGTTTG
CATAGGGCCACACACATTAGAGTAAATCACCTCAAGTTTATCTTTTGCCCTGATTGGTACATTTTGTTTGAAAGTGCTTC
TTGATTGCTTACACTGTAAACAACCATCACATACTTCACTAGGAGGCTTGATCTGAGGAAAACCCAGCATCATTTCTCTT
GAGTTTAGCTTAATCAGATCTCTAAAATTTAAATGGCCAAATCTGTAATGCCATAACCACTCTTCACTGTTTACTGTAGT
AGTAAAACACTTCTGTTCTATCACATCAATCTCAATTTTAAATGTTCTATTTTTTGAAAGAGGGGACTTCAAAATGAGCT
TGTGATTTCTGTCAAACACTCTCAACATCTTGTTTTCAAGCTTAGTCATAAAGCCCTTTTCTAATAATTGACCTAAGCTG
AGTAGATTACTTTTCATACTTGGTACAAGGAGTACATCAGTGATGCAAGATTGACCTCCATCCTTTGTTTTGATAATGAC
CTTCCCAATTCCTTCAACAGTCAAGATTCTATCATCAACAAATTTGACTTGGCTCTTCACAGATTGATCAAGGTTGAGAA
ACCACTATCTTCTTCCTGTCATATGAGTGGAGCAACCTGTGTCTAGGTACTAACAATTATCACTTGCCCCTTCAATTTGA
GTAGTTACCATTAGTAGTACCTGTTCAGTGTCATCATCTTCTTCCTGAGCCAATTTTGCATCATCACCTTTAGGTTCTCT
TTTGTTATTGGGTTTGCTGTAACACTCATAAGCAAAATGCCCAAACTTTTGACAGTTAAAGCATTGAATACTTCTTTTGT
CGAACTTCTTTACTGTTCTGATTTCCCCTCCATTTATTGCTCTTTGCTTCAGTTTTCTCTTTCTTCCATCTATCACCATG
CTTCTTTGGATTAGACCGTGCTTGCAAGGCTTGTTCACTTTTCTTCTCATTTATCCTTTCATTCATTCTCTGTTCATGAG
ATTCCAAAGATCCTTGCAATTCCTCTAGGCTAAGCTCTTCAATATTTTTGGATTCCTCGATGGCTACCACAATATGGTCG
AACTTGGGTGGCATGGTTCTAAGCACCTTCTCTACAACTGATTGCACCGTTATCTTTTCTCCATAGCCCTTCATTGAATT
CACCACTGTCTGCACTTTTGTGATGTACTCAGCAACTGATTCATTCTTTTCCATTTGTAGTAGTTCATATTGTCTCCTCA
GAGTTTGTAGCTTGATCTTTTTGGTTTTTGTGGCTCCATCATGAGATTTCTGCAGAATGTCCCATGCTTCTTTGGAGGTT
TGAGCCATTGCTATCTTTTCAAAGTTAGCAACATCTACACTTTGGTGCAAAATGAAAAGTGCCTTGCAATCTTTCTTTTC
TTTTTCTCTATCAGCAGCCTTTTGTTCATCTGTTGCTCTCTCTCCGACAGGTATATAACCTTCTTCTATGAACTCCCAAA
CCCCTTGGAATCGCATCACCACCCTAATCTGAATCTTCCAATTTTCATAGTTCTTTCCTGTGAGAACTGGTAGATTTGCA
GGAATTGAGCTAGATACTGCAGCCATCAAAGAACTCCTTCAAGAACACCTCCAAGAACCTTTTTTTAGCGATTCTTGCCC
TTTCTATCGAAACCAATGCTCTAGATACCAATTGTTGGAACACACACGGTTCCTCACTCAATTGTAAGAGATGCAATTCA
CACCCTCACACATTCACTCATGTATCACTCACTGTTTTCAAGCAAAGAATTGCACACACACTAGGAATAGCACTAGAGAC
TGAAAATGATAGAATTAAAACAACACTTTATTAAGATGTATGATTGCCCTTTTATACAAGCAAAACAAAGTAACAACCCT
TCACTCTTAGGCTAGCACTTATAATAGAATTTTAAAAATTCTATTACTCTCTCTTATATACAAAGCCAAAACAGAATTAA
ACTCTCACA





USDA Logo
Iowa State University Logo