SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RLC_Gmr116_Gm6-2
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LTR
Super Family   Copia
Family   Gmr116
Description   INTACT
Chromosome   Gm06
Start Position   18176790
End Position   18181285
Sequence   TGTAAGGAGATATCTGAATATGCATTTGATTTTGCATTGCACAAATTTGAACAAATTCTTTTTACATACATTTGAGATGT
GAAGATGAGACTTCATTATATACAGCTAGATGTAACTACTTTAGCTATAAAGATGGAGTTTTTTATAACAACCTATAGGA
AGTTATTTTCCTCTATCCTTTACATCCCCCGCAAACTGATAGTGGGTAATTGATAAACATTCAGTTTGGGTCGAAGGCTC
AAAAAAGTACTACTTGAGGGAGCCTCGGTTAGAAGATCAGCTACTTGAAATTATGAGCGTATGTGCTTGACAACTATTTC
TCCATTTGCAGCCTTTTCACGGACAAACCAGAGGTCCACTTCAAAATGTGTTGATTTTGAATGCAACACTGTATTAGCTG
TTATCATTACAACACCATGATTATCAAACCACAATAAAGGAGGCTTTGTTTGGATGATATGCAATTCAGTAAGAAGGGAC
TTGAGCCATTTAATTTCGGCAATTAGAGCTGCTAAGCTTCATAATTCTGCTTCAGTGCTAGACCTAGAAACTGACTGTTA
CTTCTTCACAAGCTAGGACACAAGATTATTTCCCAGATAAACATAGAATCTTGAGGTGGACCTCATATCAGAGGAGTCAC
AAGCCTAATCTGAATCACTATAGCCAGTCATAAAAAGATTCTGTGAAGGATAAAATGCTAAACCATGATCAATAGTACCA
TTGAGATATCGCAGAACACGTTTTGTAGCTTTGCAATGACATTCAAGAGGGCTATGCATAAACTGACATAGTTTATTGAC
TGCATAAGCTATGTCTGGACGTGTTATGGTGGCATATTGCAATGCTCCAACCACAGATTTGTATAAAGTTGGATTAGAAA
AGGAATTAGTACCATCCATATGCAGTTTCGAACCAGGGGCTAGAGGAGTCTTTATGGGTTTTGCATTATGCATGTTGACT
TTGGATAAAAGATCAGTTATGTATTTGGATTAAGAGAGGAGAAGAGCACCAGTAGTAGTGTGTTTGGCTTCAATGCCTAA
GAAAAAGTGTAAGGTACCAAGGTCTTTGAGAGGATACAGAGAGTGGAGTTTGGAAATCATAGACTGGATTTTAGAGTTTG
AGTTGCCTGTTATTATGATATTTGGACTGAGAGAGGAGAAGAGCACCAGTAGTAGTGTGTTTGGCTTCAATGCCAAAGAA
AAAGTGTAAGGTACCAAGGTCTTTGAGAGGATACAGAAAGTGGAGTTTAGAAATCACAGACTGGATTTCGGAGTTTGAGT
TGCCTGTTATTATGATATCATCAACATATATCAGAATGTATGTGATGAATTTTGGTGTAGCCTGCACAAAAAGAGATGTA
TCACACCTAGCTGGCTTAAAACCAAAGGAAATTAGACTGGATGCCAGCTTGGAAAACCAAGCTCTTGGTGCCTGCTTAAG
CCTATAGAGAGATTTCTTCAATTTACAGACAAGATGAGGATTGGCAAAGACGAAGCCCTCTGGTTGCTGCATATATACTT
CTTCTTGAATGGAACCATTTAGGAAAACATTGTTAATGTCTACGTGTCGTATATACCATTTTCTGGTGACAACAATGCTC
AAGACCGTTTGAATGGTTGTTGGTTTAATAACAGGACTGAATGTCTCATTATAATCAAGGCCTGGTCGTTGAGAATACCC
CTAAGCCACTAGTCTAGCTTTATGTCTGGCTACAGAGCCATCAACATTGTATTTCAGCCGATATATCCATTTAGAACCAA
TAGCCTTCCTATGAGGAGGCAAAGGGACGAGATCCCATGTTTTATTTTGCATGAGAGCCATGTATTCATCCTTCATTGCA
GCTAACCATTGAGGATCTTGCATAGCATCCTTGGTACATCTGGGAGTGATCTTTTTCAGTAAAGCTTTGGGTTTAAAGAC
ACCAGATTTAGCTCGAGTAGTCATAGGGTGAGCATTGGTTGTAGGAGTAGGGTGAGGAGGTTGTTCAGGGATAGAGTTGA
TAGGGCCAGGAATAGTAGGTGAAGTGGTAATAGGATTAGTTAAGGGAGTTGTGATTTCAGCTGGTGTTTGATTCGGAGGA
ATGGTAGTATTGATTTTTGGTATAGAGGGAGGGAGAGTAGAGAGAGTGGAGGGAACAAACGTATTTTGAGCAAAAAGGAT
GGGTTTGTTATCAGAGGATATTGGGTTTCATCAAATATGATGTGCCTGACAGTGTACTCCTTTCCAGAGTTAGTGATACA
TTTATAGCCTTTGTATTTAGTGTTGTAGCCAAGGAATATGCAGGGGGTGGATCGAAAATCAAGTTTGGTTTTGGTGTAGG
GTCGTAAATAAGGATAGAAAAGACACCCAAACGATTTGAAAATGGAGTAGTCAGGGGTTTTGTGAAAAAGAACCTCAAAG
GGGGGCTTGTAGTTGATCACCAGAGAGGGTATGCGATTGATGATGAAGGTGGCAGTGCTAAATGCTTCTACCCAGAATTT
TGAAGGAAGGGAGGAAGCAGCTAACAAGGTGAGACCTGTTTCAGTCAAATGGCGATGTTTCCTTTCTGGGGCACCATTCT
GCTCATGTGTATGAGGACATGAGATGCGGTGTTGTATTCCATGATCTGCAAGGTACTTAGTCAGCGCAAGGTACTCCTTG
GCACCATCAGTTTGCAGAGCTTTGATCTTGGTATTGAGTTGTAACTCTACCATTGTTTTGAATTGAATGAAGACTGATGG
AACTTCTGACCTGTCTTGTAAAAAATACAGCCAAGTGAATTTACTATGAGCATCCATAAACAGAATATAGTATCTATAGC
CTTCTTTTGAAGGTATGGGAGAGGAATCCCATATATCAGTGTAAATCAAATCAAGGGGATAGTGATAAATGGAATCAGAA
ACTAGAAATGGTAATTTATGCACTTTGCCAAGACAACATGCTTGGCACACTGATTTATTTTTTTCAGAACATGGAATACG
ACAAAGTTCAAGACATATTTGACAATTTTATTTGAACAATGACCTAGCCTTCTATGTTAGGTATCAAAATTATTAGCACG
AACAGTAGAATTAAAGGCAAACATAGGAGATTTTAATGTTGGAGAAATGAGCTTCAGATCTTCAAAGACATAGAGTTTAT
CCTTAAGGCGGCCTTTGAGAAGAACCTACTGAGTTTCCTGACATTTAACCACACACTTGTTAGAATGAAATTCAAAGAAA
ACACCATTGTCCTTTGCAAATTGGGAAACATAGATAAGATTTTTGGTTATATCAGGAACATATAACAGATTTTGTAGGGT
GAAATGAATATTTGGATTTTTTGAGTAAAAAGATGAATGTCTAGCATGAGAAATGGTTAGAGCAGTACCATCTCCCACCT
GCACACGATCACCTCCATTGTATTCATTTTTTACCATGAGATTGCCAAGATCATGTGTTAGATGGTGGGTAGCACCGGTG
TTCGGATACCAAGAATCATCTATGTGATTTGTAGAGGCTGCAAGCATAGCCTGAGCAGAGTGGTTGTTGGAGTCATCATT
TTGGCTTTGGGTCGCATGTAAGGTTGGTGCAGTGAGATTTTCATCAAAGCGATACCAACAGTGAAACACAGAATGAGCAA
CACGGCCACAAAGTTGACATTGGAGCTTTGGACCACGACCTTGTGTGGAAAAGATAGGGTTATATCTGTCATCGCATCCT
CTGCCATGATTTCCTAATATGCCTGGACCACGGCCACAAGGAGTGTTGGGAAACCCTCTTCTTGATTGATTTTGACAATG
GACAGTGTGTGCTTGAATAGGGGTGGTGTCCCTTTGTTTATGATGCTCCAATCTTTCTTCTTGGTGCATGAGAGAGGCTT
TGATTTGAGGAACAGTGAAAGGTTCGGATCGGGTGAGACACGAAGAGATGAGCCCATCGTACTCCTCAAGAAGACCATCA
AAGATCGCATCAATGTGTTCTTCATCTGTTAAGGGAGAGCCGATTGCACCAAGGGTTTTGACAATCTTCTTGATTTGGAC
CAAATACTCGTTGATTGATCCATGTTTCTTGATGTTTCGAAGTTGAATGCGAAGTTACTTGATTCACGCTTTCATTTGTG
AAGAAAAATAGGTTTTTAGAATGGCCCAAATTTCATGCGACTAGACGCAGCCAACAATGCGAACACGAAATTGATTATCC
ATCGATTCCAAAAGCCAATATTTGAGAAGATTATCCTGCTGCTCGAAATTATCATAGGCGGGATTGACGAAATCTTTCAC
CTCATCTTCGTTGTTGAGAAACTTCGGGGGAATTGTGTGACCCCCAGCGATATGCTGTTTCAAGCGGTATCCTTTGATGG
TTGATTCGAATATGCATTTGATTTTGCATTGCACAAATTTGCACAAATTCTTTTTGCATACATTTGAGATGTGAAGATGA
GAATTCTTTATATACAGCTAGATGTAACTACTTTAGCTATAAAGATGAAGTTTGTTATAACAGCCTATAGGAAGTTATTT
TCCTCTATCCTTTACA





USDA Logo
Iowa State University Logo