SoyBase and the Soybean Breeder's Toolbox Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Molecular Biology for Soybean Researchers



   
   
Element ID   RIu_Gml2_Gm9-4
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LINE
Super Family   Ukn
Family   Gml2
Description  
Chromosome   Gm09
Start Position   37490904
End Position   37494133
Sequence   AGATGCAGTAAACTGTAATTGCTATAGTCAGACAATGAAATTTTCCTTGAACACTTGATGTAGATCTGCCCTTAATTAAA
TAGTCAGTAATGCGCTGCAAAGAAGTGAAACGTCTGCGGAAAGGAGCCAAATCACGAATGTGAGCCCAAACTTGAAGAGA
TTTCCTGCAAGAAAAGAACAAATGAGCATTTGACTCAGCCTCATTTGAACATAAAGGGCAGAGGAAACCCTTGTTCAAAA
AAGCAGTTTTGTCAAGAGTAAGCAGCCAGCTCCTTTTAGCAAGCCATAGAATGAAAGACATTTTAGGGGGGATTGCTGGG
TTCCATATAACAAAACACCAACTAATAGTAGGCTTGACACCTCTAATGTATTCATAGACTTTGCCAACAAGCAATTGTTC
ATTGGTGCTCCAAGATTGAATCTTCTTTTTGGCCTCTTCCGTACTTAGCTCTTTGGAGATAATAAAGTCCCTTATTTGAA
TGCTTTTCTTTATCAAAACTGAATCTGATGAAGAAGTATTGTAATTCCACACATCGCTCCCTCTGAAATAGTAATGGTGA
ACCCACCGAATTCATAAAGAATCTTTCTTACAATTAAAGTCCCACATGATACGGGAAAGAAGTGCAAGGTTCCAGTCCTT
GAGATTAAAAAGGCCTAAACCCCCTTCTTTTTTCGGAGAACAAACTATTGACTAAGCAACCAAGGGCTTATTTTTGCCAA
TATCCGCTTTGCCCCACAGAAAATTACGGCACGAAGCGTTGATCCGGTCCAGAACAGATTGAGGCAAAGGAAAAATCCCC
ATCCAGAAATTCACAATTCCTTGAATAACTACTCTGATCAACTCTAGCTTACCTGCATAAGATAAAGACTTCTTGCTCCA
TCCCTGAATCAGGCCAGTAATCTTGGAAAGCAAGGGAGCATAGTGACATACATTTAATCTAGATGATAAAAGGGGAACAC
CCAAGTATCTAAAAGGGAAGCCACCCAAGCGAAATCTAATAAGCTGTTGAATATGAGAAAGCTCATGAGGCCTAATACCG
GCTGAGTATATGGCAGATTTATCAGAGCTGATGGAAAGCCCCGAAACCCTACAGAAGTGCTGAAGCTTGGCAAACATAGT
TGACACAGAAGGGATATCTCCTCTAGATAGAAGCATAATATAATCTGCAAAAGCCAAATGAGATAGCAGAATATCTGCAC
AGTTGGGATGAAATTTAAAATTGGCATCATCCTTGAGGCTGCTCATATCTCTGGAAAAGTACTCCAAACAAAGCACAAAC
AGATAAGGGGAGAGAGGATCCCCTTGTCTAAGACCCCGCTGTCCTTTGAAGTGGCCATAAATGGATCCATTGACTGTCAC
ACTAAAGGAAGTGGAAGAAACACATTCCATGATCCAAGTACAGAACTGGGCTGGGAAGCCAATGGACTTAAGCATCCAAT
CCAAGAATTCTCAGGAAATGGAATCATAAGCTTTATGCAAGTCAATTTTCAGGAGGCATCTCAGAGAGGATCTTTTCCGG
GAATATTTGCGCAAAATCTCTTGAACTAGGAAGATGTTGTCCATCATCTTTCTGTTCTTAGTGAAGGCAGTTTGAGATTC
CCCAATAATAGTCTCAAGCACTGGGGCTATGCGGTTGACAAAAATTTTAGACACAATCTTGTATAACAAATTACAGCAAG
ATATGGGTCTAAAATGGTTAACCTGGGAGGCCTGATCATGCTTAGGAATAAGCGCAATAATAGCATGGTTGATCTGCTTT
AAAATATTTCCAGTTGAAAAGAATTCATTAACCGCCGCAAAGATATCATCACCAATGATATTCCAAGCCTTCTTGAAGAA
TAAAGCATTGAAACCATCTGGCCCAGGAGATTTATTGTTATCTATCACAAAAATAACATTCCAAACCTCTTGCTTAGAAG
TAGGACAAAGTAAGGCCGTAAAGCAATCGGTGGGAACCTTAGGACCCTTGTTGTAGATCGAAATGGAAGGAGTTTGGGTC
AGCTCATGAGCACTAAACAAATTCCTAAAGTGATTCACAAAAGCAAGGGCAATTTCATCTTGGGAGGAAGTGTTATGCCC
ATCCTCTAGCCTTATGGTAGCAATAAACCGACTGTGTATGTTGTGCTTGATTAAAGCATGAAAAAATTTGGAGCATTTAT
CAGCCTGCAGGAGATATCTGTTTTTTATGAGCTGAGCAAACTTCATAGACTCCATTTTTCTAAGCATAATGGTCTGCCCT
CTAGTGTGGTTTTCCAGAGCAAGAAGGGAAGGATCCTGAGGATATTGCTTTAGAGAATTAAGCACACTGTTATATTCAGC
CTCAATTAGCTCTACTCGGTTGGAGATGTTGTTGAACTCCTGCTTAAAAAGATTCTTCAATGGAGCTTTAAGAGCTTTCA
ATTTCTTACAGACCTTGAACATGCTACAGCCATGAATATTTTGCTTCCAGCCATCTGCAACAATTCTTGAGAAATTTGGA
TGATCCACAATAGCATTATTGAATTTAAATGGAAAATTACCTCTAGGCACTACCAACTCAGTGGTGACAACTAGAGGAGT
ATGGTCTGAAATAGAAATAAACTTCATAACTTCACAAGCAGAATTTCCAAAGGAATTGAACCAGGCTTGATTATATAAAG
CTCTGTCCAGTTTGCTCCACACCCTGCCATTAGTCCACGTGTACAAGGAGCCATGAGTGTTGATGCTCCGCAGCCCCAAG
TCAGAATAACAATCAACAAAATCTTGCAACTCATAAGCATTGGGCTCAGCTACATTGAAATGGTCGGTGGGAGACAGAAT
GGAGTTGAAGTCACCAATGAGGAGCCAGGGGCAGTTCATATTAACATTGATACTATTTAGATTTATCCAAATAGATCTTC
TTGCCACAATGGAGTGAAGACCGTAGATGAATGAAACCTGAAAGTGCTTGGCAGTGGTTTTACAATCAATAGCACAGTGA
ATCAATTGGGCATTTGACTCCAAAACAGAAAGATGAATCTTATCCTACTTCTAGAGGATAAGAATTCTGCCAGCATTATG
AGAAGCGAAGTTATGGGTGAAGTGCCAGTCACCAAACTTTCTTATCATGATTTCCTCAATTGAAACCTTATTCAACTTAG
TTTCCAACACAGCCATGACGTTAACTTCCTTGCAGCAAAGGAAGCTTTGCATCGCATGATGCTTCAGAGGCAAATTAAAG
CCTCTGATGTTCCAAGAGGCAATGATCATG





USDA Logo
Iowa State University Logo