SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



   
   
Element ID   RIu_Gml5_Gm15-1
Reference   Du et al. 2010 BMC Genomics 2010, 11:113
Class   I
Subclass   I
Order   LINE
Super Family   Ukn
Family   Gml5
Description  
Chromosome   Gm15
Start Position   41243029
End Position   41243997
Sequence   GAAGACACTTATACAATAAGTAGGAATGGCTTGTGCACGAGACTTAATGAGAATTTCTTTGTCCACTTTAGATAAGTCCC
ATCTTGGCCAATGACTAATGTGCTTCCAAAGTCTATCTTTGAGGGATCCAAAATATTTTTCTTTTTTCTCCCTGTGAAGA
AGGTATAGCCAACTATTTGCTTGTGCTAATGTAGTCTAACCCACCAAGGAAAAAATATATTTTTTGCCTCATGGTACATG
AAGTATTTGTGCTGAAATAAATCTCAAATTTCTGATAGTTGATTGCTTGTCTATATGCCTTCCTTCTCATAAATTTCAAG
AATATTCATGAAAATTGAAGTTTCCTTTTTATTTGCCTTACAAAACAAAATAATTGTTAGCAAATAAAAAAGGTGATAGG
ATTGGAGCCCCTATGCACACCTTAATATCATGAATATCACCTCTACTCTCTAGTTTTTCAAAAGTGAGGAAAGACCCTCA
ATACAAAGAATAAAAAGACAGTGACAATTGGTCATCCATTTTGAGTCCTCTCCCTGGAAAAATAAGCCCTACGAAATCCA
TATTTACCAAAACTAAGTACTGAACAATTTCCAAACATAATTTCAAACAACCAATGCATTTTTTTATGAAAGCCCATTTT
AGCCAAAACACTCAAGAGATAATTCTAATCAACATTGTCAAAAGCCTTGCTTTATCAATTTTCGATGCAACTTTTCCCAA
ATTTCCTTTGTTTTACACCTCATGTGGTTGATAATTTCATAAACAGTAAGGATATTATCAAGAATAGAATGACCTTCAAC
AAAGGAAAAGTGTTCATGTGAGATGCATTTTAGGAGAAAAGGCTAAGACAGTTGGCAAGGGTTTTGGATATAATTTTATA
AAGGACATTGCAAAGAGAAATTGACCAAAAATCTCTCATACTTCTAGGACTATTGTTCTTAGGAATAAGATCAATGGCCG
TAGAATTTA





USDA Logo
Iowa State University Logo