SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma.18g018600

Feature Type:gene_model
Chromosome:Gm18
Start:1365145
stop:1368075
Source:JGI
Version:Wm82.a2.v1
High confidence:yes



A previous version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G22240.1AT myo-inositol-1-phosphate synthase 2 JGI N/AIEA
AT5G10170.1AT myo-inositol-1-phosphate synthase 3 JGI N/AIEA
GO:0006021GO-bp inositol biosynthetic process EnsemblGenomesN/AIEA
GO:0006021GO-bp inositol biosynthetic process JGI N/AIEA
GO:0008654GO-bp phospholipid biosynthetic process EnsemblGenomesN/AIEA
GO:0008654GO-bp phospholipid biosynthetic process JGI N/AIEA
GO:0005737GO-cc cytoplasm EnsemblGenomesN/AIEA
GO:0004512GO-mf inositol-3-phosphate synthase activity EnsemblGenomesN/AIEA
GO:0004512GO-mf inositol-3-phosphate synthase activity JGI N/AIEA
KOG0693 KOG Myo-inositol-1-phosphate synthase JGI N/AIEA
PTHR11510Panther MYO-INOSITOL-1 PHOSPHATE SYNTHASE JGI N/AIEA
PF01658PFAM Myo-inositol-1-phosphate synthase JGI N/AIEA
PF07994PFAM Myo-inositol-1-phosphate synthase JGI N/AIEA
PWY-2301SoyCyc9 myo-inositol biosynthesis Plant Metabolic Network ISS
PWY-4661SoyCyc9 1D-myo-inositol hexakisphosphate biosynthesis III (Spirodela polyrrhiza) Plant Metabolic Network ISS
GN7V-47587SoyCyc9-rxn inositol-3-phosphate synthase Plant Metabolic Network ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE


View a gene family containing related genes from other legumes at LIS

Gene families from Phytozome are displayed using the PhyloTree viewer developed by LIS.


View gene and ortholog information at SoyMine

Gene information in SoyMine developed by LIS.


ParalogEvidenceComments
Glyma.11g238800 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.35.

Corresponding NameAnnotation VersionEvidenceComments
Glyma18g02210 Wm82.a1.v1.1IGC As supplied by JGI



Annotation data from JGI Version Wm82.a2.v1
FeatureFeature NameChromosomeStartStop
GENEGlyma.18g018600 Gm1813651451368075

>Glyma.18g018600.1 sequence-type=primary primary transcript locus=Glyma.18g018600 ID=Glyma.18g018600.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
CAGGGGCATCCAACAACCGTTCACAAATCTTTTCTAAGTGTAGAAGAGGAGAGGAACCGCGCCAACCCTCtcttcttcttcttcttcAATCCTTTTATAACCTTTATAGTTTCATTCTTAATCGTTGGGAAAAATGTTCATCGAGAATTTTAAGGTAGAGAGTCCTAATGTGAAGTACACCGAGACTGAGATTCAGTCCGTGTACAACTACGAAACCACCGAACTTGTTCACGAGAACAGGAATGGCACCTATCAGTGGATTGTCAAACCCAAATCCGTCAACTACCAATTTAAAACCAACACCCATGTTCCAAAATTGGGGGTGATGCTTGTGGGTTGGGGTGGAAACAACGGCTCTACCCTCACCGGTGGTGTTATTGCTAACAGAGAGGGCATTTCATGGGCTACAAAGGACAAGATTCAACAAGCCAATTACTTTGGCTCCCTCACCCAAGCCTCAGCTATTCGAGTTGGATCCTTCCAGGGAGAGGAAATCTATGCCCCATTCAAGAGTCTGCTTCCAATGGTTAATCCTGACGACATTGTGTTTGGGGGATGGGATATCAGCAACATGAACCTGGCTGATGCCATGGCCAGGGCAAAGGTGTTTGACATCGATTTGCAGAAGCAGTTGAGGCCTTACATGGAATCCATGGTTCCACTCCCCGGAATCTACGACCCGGATTTCATTGCTGCCAACCAAGAGGAGCGTGCCAACAACGTGATTAAGGGCACAAAGCAAGAGCAAGTTCAGCAAATCATCAAAGACATCAAGGCGTTTAAGGAAGCCACCAAAGTGGACAAGGTGGTTGTCCTGTGGACTGCCAACACAGAGAGGTATAGCAATTTGGTTGTAGGCCTTAATGACACCATGGAGAATCTCTTGGCTGCTGTGGACAGAAATGAGGCTGAGATTTCTCCTTCCACCTTGTATGCCATTGCCTGTGTGATGGAAAATGTTCCTTTCATTAATGGAAGCCCTCAGAACACTTTTGTACCAGGGCTGATTGATCTTGCCATCGCGAGGAACACTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGACCAAAATGAAATCTGTGTTGGTTGATTTTCTTGTGGGGGCTGGTATCAAGCCAACATCTATAGTTAGTTACAACCATCTGGGAAACAATGATGGTATGAATCTCTCGGCTCCACAAACCTTCCGCTCCAAGGAAATCTCCAAGAGCAACGTTGTTGACGATATGGTCAACAGCAATGCCATCCTCTATGAGCCTGGTGAACATCCCGACCATGTTGTTGTTATTAAGTATGTGCCTTACGTAGGGGATAGCAAGAGAGCCATGGATGAGTACACTTCAGAGATATTCATGGGTGGAAAGAACACCATTGTTTTGCACAACACATGTGAGGATTCCCTTTTAGCTGCTCCTATTATCTTGGACTTGGTCCTTCTTGCTGAGCTGAGCACTAGAATCCAGTTTAAAGCTGAAAATGAGGGAAAATTCCACTCATTCCACCCAGTTGCTACCATTCTCAGCTATCTGACCAAGGCTCCTCTGGTTCCACCGGGTACACCAGTGGTGAATGCATTGTCAAAGCAGCGTGCAATGCTGGAAAACATAATGAGGGCTTGTGTTGGATTGGCCCCAGAGAATAACATGATTCTCGAGTACAAGTGACGCATGGGATAGAATAATAATTTTGTTGGGGTAGCCTATCCGAATGGTTTATGTTAATAATATGTTTGCTTATGATTTTGCAAGTGTAATTGATTGCATCTTCTCATTAATGCTTTAGAGCAGGACATATTCTGTTTTCTAGGGACATGAATGAATGTAGTATAATTTTGTGTACTTTATCCTCTTACC

>Glyma.18g018600.1 sequence-type=CDS polypeptide=Glyma.18g018600.1.p locus=Glyma.18g018600 ID=Glyma.18g018600.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGTTCATCGAGAATTTTAAGGTAGAGAGTCCTAATGTGAAGTACACCGAGACTGAGATTCAGTCCGTGTACAACTACGAAACCACCGAACTTGTTCACGAGAACAGGAATGGCACCTATCAGTGGATTGTCAAACCCAAATCCGTCAACTACCAATTTAAAACCAACACCCATGTTCCAAAATTGGGGGTGATGCTTGTGGGTTGGGGTGGAAACAACGGCTCTACCCTCACCGGTGGTGTTATTGCTAACAGAGAGGGCATTTCATGGGCTACAAAGGACAAGATTCAACAAGCCAATTACTTTGGCTCCCTCACCCAAGCCTCAGCTATTCGAGTTGGATCCTTCCAGGGAGAGGAAATCTATGCCCCATTCAAGAGTCTGCTTCCAATGGTTAATCCTGACGACATTGTGTTTGGGGGATGGGATATCAGCAACATGAACCTGGCTGATGCCATGGCCAGGGCAAAGGTGTTTGACATCGATTTGCAGAAGCAGTTGAGGCCTTACATGGAATCCATGGTTCCACTCCCCGGAATCTACGACCCGGATTTCATTGCTGCCAACCAAGAGGAGCGTGCCAACAACGTGATTAAGGGCACAAAGCAAGAGCAAGTTCAGCAAATCATCAAAGACATCAAGGCGTTTAAGGAAGCCACCAAAGTGGACAAGGTGGTTGTCCTGTGGACTGCCAACACAGAGAGGTATAGCAATTTGGTTGTAGGCCTTAATGACACCATGGAGAATCTCTTGGCTGCTGTGGACAGAAATGAGGCTGAGATTTCTCCTTCCACCTTGTATGCCATTGCCTGTGTGATGGAAAATGTTCCTTTCATTAATGGAAGCCCTCAGAACACTTTTGTACCAGGGCTGATTGATCTTGCCATCGCGAGGAACACTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGACCAAAATGAAATCTGTGTTGGTTGATTTTCTTGTGGGGGCTGGTATCAAGCCAACATCTATAGTTAGTTACAACCATCTGGGAAACAATGATGGTATGAATCTCTCGGCTCCACAAACCTTCCGCTCCAAGGAAATCTCCAAGAGCAACGTTGTTGACGATATGGTCAACAGCAATGCCATCCTCTATGAGCCTGGTGAACATCCCGACCATGTTGTTGTTATTAAGTATGTGCCTTACGTAGGGGATAGCAAGAGAGCCATGGATGAGTACACTTCAGAGATATTCATGGGTGGAAAGAACACCATTGTTTTGCACAACACATGTGAGGATTCCCTTTTAGCTGCTCCTATTATCTTGGACTTGGTCCTTCTTGCTGAGCTGAGCACTAGAATCCAGTTTAAAGCTGAAAATGAGGGAAAATTCCACTCATTCCACCCAGTTGCTACCATTCTCAGCTATCTGACCAAGGCTCCTCTGGTTCCACCGGGTACACCAGTGGTGAATGCATTGTCAAAGCAGCGTGCAATGCTGGAAAACATAATGAGGGCTTGTGTTGGATTGGCCCCAGAGAATAACATGATTCTCGAGTACAAGTGA

>Glyma.18g018600.2 sequence-type=CDS polypeptide=Glyma.18g018600.2.p locus=Glyma.18g018600 ID=Glyma.18g018600.2.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGTTCATCGAGAATTTTAAGGTAGAGAGTCCTAATGTGAAGTACACCGAGACTGAGATTCAGTCCGTGTACAACTACGAAACCACCGAACTTGTTCACGAGAACAGGAATGGCACCTATCAGTGGATTGTCAAACCCAAATCCGTCAACTACCAATTTAAAACCAACACCCATGTTCCAAAATTGGGGGTGATGCTTGTGGGTTGGGGTGGAAACAACGGCTCTACCCTCACCGGTGGTGTTATTGCTAACAGAGAGGGCATTTCATGGGCTACAAAGGACAAGATTCAACAAGCCAATTACTTTGGCTCCCTCACCCAAGCCTCAGCTATTCGAGTTGGATCCTTCCAGGGAGAGGAAATCTATGCCCCATTCAAGAGTCTGCTTCCAATGGTTAATCCTGACGACATTGTGTTTGGGGGATGGGATATCAGCAACATGAACCTGGCTGATGCCATGGCCAGGGCAAAGGTGTTTGACATCGATTTGCAGAAGCAGTTGAGGCCTTACATGGAATCCATGGTTCCACTCCCCGGAATCTACGACCCGGATTTCATTGCTGCCAACCAAGAGGAGCGTGCCAACAACGTGATTAAGGGCACAAAGCAAGAGCAAGTTCAGCAAATCATCAAAGACATCAAGGCGTTTAAGGAAGCCACCAAAGTGGACAAGGTGGTTGTCCTGTGGACTGCCAACACAGAGAGGTATAGCAATTTGGTTGTAGGCCTTAATGACACCATGGAGAATCTCTTGGCTGCTGTGGACAGAAATGAGGCTGAGATTTCTCCTTCCACCTTGTATGCCATTGCCTGTGTGATGGAAAATGTTCCTTTCATTAATGGAAGCCCTCAGAACACTTTTGTACCAGGGCTGATTGATCTTGCCATCGCGAGGAACACTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGACCAAAATGAAATCTGTGTTGGTTGATTTTCTTGTGGGGGCTGGTATCAAGCCAACATCTATAGTTAGTTACAACCATCTGGGAAACAATGATGGTATGAATCTCTCGGCTCCACAAACCTTCCGCTCCAAGGAAATCTCCAAGAGCAACGTTGTTGACGATATGGTCAACAGCAATGCCATCCTCTATGAGCCTGGTCTTTGA

>Glyma.18g018600.3 sequence-type=CDS polypeptide=Glyma.18g018600.3.p locus=Glyma.18g018600 ID=Glyma.18g018600.3.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGTTCATCGAGAATTTTAAGGTAGAGAGTCCTAATGTGAAGTACACCGAGACTGAGATTCAGTCCGTGTACAACTACGAAACCACCGAACTTGTTCACGAGAACAGGAATGGCACCTATCAGTGGATTGTCAAACCCAAATCCGTCAACTACCAATTTAAAACCAACACCCATGTTCCAAAATTGGGGGTGATGCTTGTGGGTTGGGGTGGAAACAACGGCTCTACCCTCACCGGTGGTGTTATTGCTAACAGAGAGGGCATTTCATGGGCTACAAAGGACAAGATTCAACAAGCCAATTACTTTGGCTCCCTCACCCAAGCCTCAGCTATTCGAGTTGGATCCTTCCAGGGAGAGGAAATCTATGCCCCATTCAAGAGTCTGCTTCCAATGGTTAATCCTGACGACATTGTGTTTGGGGGATGGGATATCAGCAACATGAACCTGGCTGATGCCATGGCCAGGGCAAAGGTGTTTGACATCGATTTGCAGAAGCAGTTGAGGCCTTACATGGAATCCATGGTTCCACTCCCCGGAATCTACGACCCGGATTTCATTGCTGCCAACCAAGAGGAGCGTGCCAACAACGTGATTAAGGGCACAAAGCAAGAGCAAGTTCAGCAAATCATCAAAGACATCAAGGCGTTTAAGGAAGCCACCAAAGTGGACAAGGTGGTTGTCCTGTGGACTGCCAACACAGAGAGGTATAGCAATTTGGTTGTAGGCCTTAATGACACCATGGAGAATCTCTTGGCTGCTGTGGACAGAAATGAGGCTGAGATTTCTCCTTCCACCTTGTATGCCATTGCCTGTGTGATGGAAAATGTTCCTTTCATTAATGGAAGCCCTCAGAACACTTTTGTACCAGGGCTGATTGATCTTGCCATCGCGAGGAACACTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGACCAAAATGAAATCTGTGTTGGTTGATTTTCTTGTGGGGGCTGGTATCAAGGTACATTGTTGTTATACTAATGTCATATCATGGGTGTTATTTTTACTAGGACAATCTATCCTTTGCATGTTTTGTAAACAATTTATGCATCGTGCTAGATTTATATGTCAAAAATGGAGAAATGAGTTGATTTTTTCAAGTGTTCTGTTGATGATTGACAGCCAACATCTATAG

>Glyma.18g018600.4 sequence-type=CDS polypeptide=Glyma.18g018600.4.p locus=Glyma.18g018600 ID=Glyma.18g018600.4.Wm82.a2.v1 annot-version=Wm82.a2.v1
ATGTTCATCGAGAATTTTAAGGTAGAGAGTCCTAATGTGAAGTACACCGAGACTGAGATTCAGTCCGTGTACAACTACGAAACCACCGAACTTGTTCACGAGAACAGGAATGGCACCTATCAGTGGATTGTCAAACCCAAATCCGTCAACTACCAATTTAAAACCAACACCCATGTTCCAAAATTGGGGGTGATGCTTGTGGGTTGGGGTGGAAACAACGGCTCTACCCTCACCGGTGGTGTTATTGCTAACAGAGAGGGCATTTCATGGGCTACAAAGGACAAGATTCAACAAGCCAATTACTTTGGCTCCCTCACCCAAGCCTCAGCTATTCGAGTTGGATCCTTCCAGGGAGAGGAAATCTATGCCCCATTCAAGAGTCTGCTTCCAATGGTTAATCCTGACGACATTGTGTTTGGGGGATGGGATATCAGCAACATGAACCTGGCTGATGCCATGGCCAGGGCAAAGGTGTTTGACATCGATTTGCAGAAGCAGTTGAGGCCTTACATGGAATCCATGGTTCCACTCCCCGGAATCTACGACCCGGATTTCATTGCTGCCAACCAAGAGGAGCGTGCCAACAACGTGATTAAGGGCACAAAGCAAGAGCAAGTTCAGCAAATCATCAAAGACATCAAGGCGTTTAAGGAAGCCACCAAAGTGGACAAGGTGGTTGTCCTGTGGACTGCCAACACAGAGAGGTATAGCAATTTGGTTGTAGGCCTTAATGACACCATGGAGAATCTCTTGGCTGCTGTGGACAGAAATGAGGCTGAGATTTCTCCTTCCACCTTGTATGCCATTGCCTGTGTGATGGAAAATGTTCCTTTCATTAATGGAAGCCCTCAGAACACTTTTGTACCAGGGCTGATTGATCTTGCCATCGCGAGGAACACTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGACCAAAATGAAATCTGTGTTGGTTGATTTTCTTGTGGGGGCTGGTATCAAGCCAACATCTATAGTTAGTTACAACCATCTGGGAAACAATGATGGTATGAATCTCTCGGCTCCACAAACCTTCCGCTCCAAGGAAATCTCCAAGAGCAACGTTGTTGACGATATGGTCAACAGCAATGCCATCCTCTATGAGCCTGGTGAACATCCCGACCATGTTGTTGTTATTAAGTATGTGCCTTACGTAGGGGATAGCAAGAGAGCCATGGATGAGTACACTTCAGAGATATTCATGGGTGGAAAGAACACCATTGTTTTGCACAACACATGTGAGGATTCCCTTTTAGCTGCTCCTATTATCTTGGACTTGGTCCTTCTTGCTGAGCTGAGCACTAGAATCCAGTTTAAAGCTGAAAATGAGGTCTGCATGCATTGCTAA

>Glyma.18g018600.1.p sequence-type=predicted peptide transcript=Glyma.18g018600.1 locus=Glyma.18g018600 ID=Glyma.18g018600.1.Wm82.a2.v1 annot-version=Wm82.a2.v1
MFIENFKVESPNVKYTETEIQSVYNYETTELVHENRNGTYQWIVKPKSVNYQFKTNTHVPKLGVMLVGWGGNNGSTLTGGVIANREGISWATKDKIQQANYFGSLTQASAIRVGSFQGEEIYAPFKSLLPMVNPDDIVFGGWDISNMNLADAMARAKVFDIDLQKQLRPYMESMVPLPGIYDPDFIAANQEERANNVIKGTKQEQVQQIIKDIKAFKEATKVDKVVVLWTANTERYSNLVVGLNDTMENLLAAVDRNEAEISPSTLYAIACVMENVPFINGSPQNTFVPGLIDLAIARNTLIGGDDFKSGQTKMKSVLVDFLVGAGIKPTSIVSYNHLGNNDGMNLSAPQTFRSKEISKSNVVDDMVNSNAILYEPGEHPDHVVVIKYVPYVGDSKRAMDEYTSEIFMGGKNTIVLHNTCEDSLLAAPIILDLVLLAELSTRIQFKAENEGKFHSFHPVATILSYLTKAPLVPPGTPVVNALSKQRAMLENIMRACVGLAPENNMILEYK*

>Glyma.18g018600.2.p sequence-type=predicted peptide transcript=Glyma.18g018600.2 locus=Glyma.18g018600 ID=Glyma.18g018600.2.Wm82.a2.v1 annot-version=Wm82.a2.v1
MFIENFKVESPNVKYTETEIQSVYNYETTELVHENRNGTYQWIVKPKSVNYQFKTNTHVPKLGVMLVGWGGNNGSTLTGGVIANREGISWATKDKIQQANYFGSLTQASAIRVGSFQGEEIYAPFKSLLPMVNPDDIVFGGWDISNMNLADAMARAKVFDIDLQKQLRPYMESMVPLPGIYDPDFIAANQEERANNVIKGTKQEQVQQIIKDIKAFKEATKVDKVVVLWTANTERYSNLVVGLNDTMENLLAAVDRNEAEISPSTLYAIACVMENVPFINGSPQNTFVPGLIDLAIARNTLIGGDDFKSGQTKMKSVLVDFLVGAGIKPTSIVSYNHLGNNDGMNLSAPQTFRSKEISKSNVVDDMVNSNAILYEPGL*

>Glyma.18g018600.3.p sequence-type=predicted peptide transcript=Glyma.18g018600.3 locus=Glyma.18g018600 ID=Glyma.18g018600.3.Wm82.a2.v1 annot-version=Wm82.a2.v1
MFIENFKVESPNVKYTETEIQSVYNYETTELVHENRNGTYQWIVKPKSVNYQFKTNTHVPKLGVMLVGWGGNNGSTLTGGVIANREGISWATKDKIQQANYFGSLTQASAIRVGSFQGEEIYAPFKSLLPMVNPDDIVFGGWDISNMNLADAMARAKVFDIDLQKQLRPYMESMVPLPGIYDPDFIAANQEERANNVIKGTKQEQVQQIIKDIKAFKEATKVDKVVVLWTANTERYSNLVVGLNDTMENLLAAVDRNEAEISPSTLYAIACVMENVPFINGSPQNTFVPGLIDLAIARNTLIGGDDFKSGQTKMKSVLVDFLVGAGIKVHCCYTNVISWVLFLLGQSILCMFCKQFMHRARFICQKWRNELIFSSVLLMIDSQHL*

>Glyma.18g018600.4.p sequence-type=predicted peptide transcript=Glyma.18g018600.4 locus=Glyma.18g018600 ID=Glyma.18g018600.4.Wm82.a2.v1 annot-version=Wm82.a2.v1
MFIENFKVESPNVKYTETEIQSVYNYETTELVHENRNGTYQWIVKPKSVNYQFKTNTHVPKLGVMLVGWGGNNGSTLTGGVIANREGISWATKDKIQQANYFGSLTQASAIRVGSFQGEEIYAPFKSLLPMVNPDDIVFGGWDISNMNLADAMARAKVFDIDLQKQLRPYMESMVPLPGIYDPDFIAANQEERANNVIKGTKQEQVQQIIKDIKAFKEATKVDKVVVLWTANTERYSNLVVGLNDTMENLLAAVDRNEAEISPSTLYAIACVMENVPFINGSPQNTFVPGLIDLAIARNTLIGGDDFKSGQTKMKSVLVDFLVGAGIKPTSIVSYNHLGNNDGMNLSAPQTFRSKEISKSNVVDDMVNSNAILYEPGEHPDHVVVIKYVPYVGDSKRAMDEYTSEIFMGGKNTIVLHNTCEDSLLAAPIILDLVLLAELSTRIQFKAENEVCMHC*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo