SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma12g02310

Feature Type:gene_model
Chromosome:Gm12
Start:1451074
stop:1455926
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G13410AT Annotation by Michelle Graham. TAIR10: unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G55546.1); Has 49 Blast hits to 49 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 48; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink). | chr3:4362149-4364032 REVERSE LENGTH=321 SoyBaseE_val: 2.00E-85ISS
GO:0000902GO-bp Annotation by Michelle Graham. GO Biological Process: cell morphogenesis SoyBaseN/AISS
GO:0006816GO-bp Annotation by Michelle Graham. GO Biological Process: calcium ion transport SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0007033GO-bp Annotation by Michelle Graham. GO Biological Process: vacuole organization SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0016049GO-bp Annotation by Michelle Graham. GO Biological Process: cell growth SoyBaseN/AISS
GO:0048193GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi vesicle transport SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_H2KX77UniRef Annotation by Michelle Graham. Most informative UniRef hit: Expressed protein n=1 Tax=Oryza sativa Japonica Group RepID=H2KX77_ORYSJ SoyBaseE_val: 1.00E-65ISS
UniRef100_I1LPB5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LPB5_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma12g02310 not represented in the dataset

Glyma12g02310 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma11g09970 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.12g020500 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma12g02310.10   sequence type=transcript   gene model=Glyma12g02310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
AAAAAATGACCATATATGCATTTAATCATTAATCACAAATAAAATTTTGGGCAGCATAGATCTGAATGGAGAGCGAGGTGGTGTCCATTGCAGTTTTCTAATGAAAACAACAAAATAGACACCTGTTAAGAAGGAGGACAACGATGGTGCTGCCGCTATTTACTGCTTTCATTCTCTTTGCTTTTATTCCGAATGGATTGTTAGCAGTTCCTTCCACCGTCCCGGCATTCCTTTGGTCATCACATTATGAACTGGCCTCTGAAAATATATTGAAGGAATCTGTAAATTACCAAGTCATTTCTCCGAAGGATCTAGCAAAATCTATTTTATCTGAAGCAGGCTGGTCAAATTTTCTGTGCAAAGGAAAGAAATTTCATGAGCCTCTGGATCTGGCACTCTTATTCGTTGGTAGAGAGTTACAATCTTCAGATTTAAGCATGAACAAACATGCAAACTCAGCTCTTTTGGACCTGCTCAAGAACTCTTTCGCCAGATCCAACACTTCTGTGGCATTTCCCTATGTTTCTACATCAGAGGATGTGCTTTTGGAAAACTCGTTGGTTTCAGGATTTGCTGAAGCCTGTGGAGATATGGGAATTGGCAATGTTGCTTTCCATGGATCTTGCTCCATTGATGATGCAAATCATGAAGAAATCACAACTTTGCACTCAGTTCAAGACTATTTGACCAAGAGGATGGAAGAGAGTCACAGAGGGAAAACTGATTTGGTTGTGTTCTGCAATGAAGGCTCTCAAGCTCTTGAGAATGTTGACAGGACACAATCTGAAGGGGAAGTTTTATCCAATCTTATCAATTCTGTGGAGGAATCTGGTGCAAAATATGCCATTCTTTATGTGTCAGATCCCTCAAGGTCAATCCAGTATCCTTCTTACAGGGATCTGCAAAGGTTTCTAGCAGAAAGTACAGCCGGGAATGAATCAACCAATTCCACAATTTGTGATGAAGTCTGCCAGATTAAATCATCTCTTCTAGAGGGAATTTTAGTGGGTATAGTTTTGCTAATAATTTTGATATCGGGCCTTTGCTGCATGATGGGAATTGACACCCCAACAAGATTTGAGACGCCACAAGAGTAATGATCCATTTGCTGAAGCTAATAAATGTTGTGATGCTCTCGGTCTACTGGATTAAAATATTACTGCTATATTATTTGCGAATGTTACGGAGGCTCTGATAAGTGTTCTGTAGTTGATGACTTATCTCAGGGACTTGACATATTGAATAATAAAATAATTTGTATCAGTATATAAAAATGAAACTTCAAGCTTAGGTTTAATTTTGATCCCGCCACCATTCAGATTATGTAAAATTTGAAGAAATTTCAGATTATGTGTTGTATTTTTTTAACTGTTCGCAAATTTGCCCCATTCGTTGTGCATAATTGCTGATCGATGCAGTTGCAAGTTTATTTCTGCTGGGTTTTGAATTGAAGTTTGAAGTTGATTTGAAGAATGTTTAGCAATATGGTAAAATTTCGAGTTAAAGTTTGAGATTGAAGTTAAAGATATTAACAAGTGGAAGTTCTAAAAGTAGACGAGTGTCAGATGAAGGATTTCAAGGTAAGGGTATAAATTGAGAGGAAGTTAATAACAATTACCTTCGCTGCATGCATTGAGTGAGATGCTGAAATTTTATGCAATTTGTTTACACGTGTTTGTATAGCATATATCAATCGTTATGGTTGGAAATCTGAATAGGATATTTATATTCTAATTTTTATTGTTGAAACAGATCGAATAGTGTTATGTTCTATACATAAATAAATGGTTACTGGTTTAACAAGTT

>Glyma12g02310.7   sequence type=transcript   gene model=Glyma12g02310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
AAAATTTTGGGCAGCATAGATCTGAATGGAGAGCGAGGTGGTGTCCATTGCAGTTTTCTAATGAAAACAACAAAATAGACACCTGTTAAGAAGGAGGACAACGATGGTGCTGCCGCTATTTACTGCTTTCATTCTCTTTGCTTTTATTCCGAATGGATTGTTAGCAGTTCCTTCCACCGTCCCGGCATTCCTTTGGTCATCACATTATGAACTGGCCTCTGAAAATATATTGAAGGAATCTGTAAATTACCAAGTCATTTCTCCGAAGGATCTAGCAAAATCTATTTTATCTGAAGCAGGCTGGTCAAATTTTCTGTGCAAAGGAAAGAAATTTCATGAGCCTCTGGATCTGGCACTCTTATTCGTTGGTAGAGAGTTACAATCTTCAGATTTAAGCATGAACAAACATGCAAACTCAGCTCTTTTGGACCTGCTCAAGAACTCTTTCGCCAGATCCAACACTTCTGTGGCATTTCCCTATGTTTCTACATCAGAGGATGTGCTTTTGGAAAACTCGTTGGTTTCAGGATTTGCTGAAGCCTGTGGAGATATGGGAATTGGCAATGTTGCTTTCCATGGATCTTGCTCCATTGATGATGCAAATCATGAAGAAATCACAACTTTGCACTCAGTTCAAGACTATTTGACCAAGAGGATGGAAGAGAGTCACAGAGGGAAAACTGATTTGGTTGTGTTCTGCAATGAAGGCTCTCAAGCTCTTGAGAATGTTGACAGGACACAATCTGAAGGGGAAGTTTTATCCAATCTTATCAATTCTGTGGAGGAATCTGGTGCAAAATATGCCATTCTTTATGTGTCAGATCCCTCAAGGTCAATCCAGTATCCTTCTTACAGGGATCTGCAAAGGTTTCTAGCAGAAAGTACAGCCGGGAATGAATCAACCAATTCCACAATTTGTGATGAAGTCTGCCAGATTAAATCATCTCTTCTAGAGGGAATTTTAGTGTTCTATGGTACCACAACTATACTCTCGTTGGGCCTGCTTGGGTAGATTGCTGTCTGTTTCTAACTACTGCCTCCAGTTTTAACAATGCAAGGTATAGTTTTGCTAATAATTTTGATATCGGGCCTTTGCTGCATGATGGGAATTGACACCCCAACAAGATTTGAGACGCCACAAGAGTAATGATCCATTTGCTGAAGCTAATAAATGTTGTGATGCTCTCGGTCTACTGGATTAAAATATTACTGCTATATTATTTGCGAATGTTACGGAGGCTCTGATAAGTGTTCTGTAGTTGATGACTTATCTCAGGGACTTGACATATTGAATAATAAAATAATTTGTATCAGTATATAAAAATGAAACTTCAAGCTTAGGTTTAATTTTGATCCCGCCACCATTCAGATTATGTAAAATTTGAAGAAATTTCAGATTATGTGTTGTATTTTTTTAACTGTTCGCAAATTTGCCCCATTCGTTGTGCATAATTGCTGATCGATGCAGTTGCAAGTTTATTTCTGCTGGGTTTTGAATTGAAGTTTGAAGTTGATTTGAAGAATGTTTAGCAATATGGTAAAATTTCGAGTTAAAGTTTGAGATTGAAGTTAAAGATATTAACAAGTGGAAGTTCTAAAAGTAGACGAGTGTCAGATGAAGGATTTCAAGGTAAGGGTATAAATTGAGAGGAAGTTAATAACAATTACCTTCGCTGCATGCATTGAGTGAGATGCTGAAATTTTATGCAATTTGTTTACACGTGTTTGTATAGCATATATCAATCGTTATGGTTGGAAATCTGAATAGGATATTTATATTCTAATTTTTATTGTTGAAACAGATCGAATAGTGTTATGTTCTATACATAAATAAATGGTTACTGGTTTAACAAGTT

>Glyma12g02310.8   sequence type=transcript   gene model=Glyma12g02310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GACCATATATGCATTTAATCATTAATCACAAATAAAATTTTGGGCAGCATAGATCTGAATGGAGAGCGAGGTGGTGTCCATTGCAGTTTTCTAATGAAAACAACAAAATAGACACCTGTTAAGAAGGAGGTGAGTTTCGTAAGATTAGGTTTTTGTTCTCTCTCTCTCTGATTCGATCGATTTCGATTGTTGAATTCATCACATCACGGAGCCTTGTACGTTGACAACGATGGTGCTGCCGCTATTTACTGCTTTCATTCTCTTTGCTTTTATTCCGAATGGATTGTTAGCAGTTCCTTCCACCGTCCCGGCATTCCTTTGGTCATCACATTATGAACTGGCCTCTGAAAATATATTGAAGGAATCTGTAAATTACCAAGTCATTTCTCCGAAGGATCTAGCAAAATCTATTTTATCTGAAGCAGGCTGGTCAAATTTTCTGTGCAAAGGAAAGAAATTTCATGAGCCTCTGGATCTGGCACTCTTATTCGTTGGTAGAGAGTTACAATCTTCAGATTTAAGCATGAACAAACATGCAAACTCAGCTCTTTTGGACCTGCTCAAGAACTCTTTCGCCAGATCCAACACTTCTGTGGCATTTCCCTATGTTTCTACATCAGAGGATGTGCTTTTGGAAAACTCGTTGGTTTCAGGATTTGCTGAAGCCTGTGGAGATATGGGAATTGGCAATGTTGCTTTCCATGGATCTTGCTCCATTGATGATGCAAATCATGAAGAAATCACAACTTTGCACTCAGTTCAAGACTATTTGACCAAGAGGATGGAAGAGAGTCACAGAGGGAAAACTGATTTGGTTGTGTTCTGCAATGAAGGCTCTCAAGCTCTTGAGAATGTTGACAGGACACAATCTGAAGGGGAAGTTTTATCCAATCTTATCAATTCTGTGGAGGAATCTGGTGCAAAATATGCCATTCTTTATGTGTCAGATCCCTCAAGGTCAATCCAGTATCCTTCTTACAGGGATCTGCAAAGGTTTCTAGCAGAAAGTACAGCCGGGAATGAATCAACCAATTCCACAATTTGTGATGAAGTCTGCCAGATTAAATCATCTCTTCTAGAGGGAATTTTAGTGGGTATAGTTTTGCTAATAATTTTGATATCGGGCCTTTGCTGCATGATGGGAATTGACACCCCAACAAGATTTGAGACGCCACAAGAGTAATGATCCATTTGCTGAAGCTAATAAATGTTGTGATGCTCTCGGTCTACTGGATTAAAATATTACTGCTATATTATTTGCGAATGTTACGGAGGCTCTGATAAGTGTTCTGTAGTTGATGACTTATCTCAGGGACTTGACATATTGAATAATAAAATAATTTGTATCAGTATATAAAAATGAAACTTCAAGCTTAGGTTTAATTTTGATCCCGCCACCATTCAGATTATGTAAAATTTGAAGAAATTTCAGATTATGTGTTGTATTTTTTTAACTGTTCGCAAATTTGCCCCATTCGTTGTGCATAATTGCTGATCGATGCAGTTGCAAGTTTATTTCTGCTGGGTTTTGAATTGAAGTTTGAAGTTGATTTGAAGAATGTTTAGCAATATGGTAAAATTTCGAGTTAAAGTTTGAGATTGAAGTTAAAGATATTAACAAGTGGAAGTTCTAAAAGTAGACGAGTGTCAGATGAAGGATTTCAAGGTAAGGGTATAAATTGAGAGGAAGTTAATAACAATTACCTTCGCTGCATGCATTGAGTGAGATGCTGAAATTTTATGCAATTTGTTTACACGTGTTTGTATAGCATATATCAATCGTTATGGTTGGAAATCTGAATAGGATATTTATATTCTAATTTTTATTGTTGAAACAGATCGAATAGTGTTATGTTCTATACATAAATAAATGGTTACTGGTTTAACAAGTT

>Glyma12g02310.9   sequence type=transcript   gene model=Glyma12g02310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GTTAAGAAGGAGGTGAGTTTCGTAAGATTAGGACAACGATGGTGCTGCCGCTATTTACTGCTTTCATTCTCTTTGCTTTTATTCCGAATGGATTGTTAGCAGTTCCTTCCACCGTCCCGGCATTCCTTTGGTCATCACATTATGAACTGGCCTCTGAAAATATATTGAAGGAATCTGTAAATTACCAAGTCATTTCTCCGAAGGATCTAGCAAAATCTATTTTATCTGAAGCAGGCTGGTCAAATTTTCTGTGCAAAGGAAAGAAATTTCATGAGCCTCTGGATCTGGCACTCTTATTCGTTGGTAGAGAGTTACAATCTTCAGATTTAAGCATGAACAAACATGCAAACTCAGCTCTTTTGGACCTGCTCAAGAACTCTTTCGCCAGATCCAACACTTCTGTGGCATTTCCCTATGTTTCTACATCAGAGGATGTGCTTTTGGAAAACTCGTTGGTTTCAGGATTTGCTGAAGCCTGTGGAGATATGGGAATTGGCAATGTTGCTTTCCATGGATCTTGCTCCATTGATGATGCAAATCATGAAGAAATCACAACTTTGCACTCAGTTCAAGACTATTTGACCAAGAGGATGGAAGAGAGTCACAGAGGGAAAACTGATTTGGTTGTGTTCTGCAATGAAGGCTCTCAAGCTCTTGAGAATGTTGACAGGACACAATCTGAAGGGGAAGTTTTATCCAATCTTATCAATTCTGTGGAGGAATCTGGTGCAAAATATGCCATTCTTTATGTGTCAGATCCCTCAAGGTCAATCCAGTATCCTTCTTACAGGGATCTGCAAAGGTTTCTAGCAGAAAGTACAGCCGGGAATGAATCAACCAATTCCACAATTTGTGATGAAGTCTGCCAGATTAAATCATCTCTTCTAGAGGGAATTTTAGTGGGTATAGTTTTGCTAATAATTTTGATATCGGGCCTTTGCTGCATGATGGGAATTGACACCCCAACAAGATTTGAGACGCCACAAGAGTAATGATCCATTTGCTGAAGCTAATAAATGTTGTGATGCTCTCGGTCTACTGGATTAAAATATTACTGCTATATTATTTGCGAATGTTACGGAGGCTCTGATAAGTGTTCTGTAGTTGATGACTTATCTCAGGGACTTGACATATTGAATAATAAAATAATTTGTATCAGTATATAAAAATGAAACTTCAAGCTTAGGTTTAATTTTGATCCCGCCACCATTCAGATTATGTAAAATTTGAAGAAATTTCAGATTATGTGTTGTATTTTTTTAACTGTTCGCAAATTTGCCCCATTCGTTGTGCATAATTGCTGATCGATGCAGTTGCAAGTTTATTTCTGCTGGGTTTTGAATTGAAGTTTGAAGTTGATTTGAAGAATGTTTAGCAATATGGTAAAATTTCGAGTTAAAGTTTGAGATTGAAGTTAAAGATATTAACAAGTGGAAGTTCTAAAAGTAGACGAGTGTCAGATGAAGGATTTCAAGGTAAGGGTATAAATTGAGAGGAAGTTAATAACAATTACCTTCGCTGCATGCATTGAGTGAGATGCTGAAATTTTATGCAATTTGTTTACACGTGTTTGTATAGCATATATCAATCGTTATGGTTGGAAATCTGAATAGGATATTTATATTCTAATTTTTATTGTTGAAACAGATCGAATAGTGTTATGTTCTATACATAAATAAATGGTTACTGGTTTAACAAGTT

>Glyma12g02310.1   sequence type=CDS   gene model=Glyma12g02310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGCTGCCGCTATTTACTGCTTTCATTCTCTTTGCTTTTATTCCGAATGGATTGTTAGCAGTTCCTTCCACCGTCCCGGCATTCCTTTGGTCATCACATTATGAACTGGCCTCTGAAAATATATTGAAGGAATCTGTAAATTACCAAGTCATTTCTCCGAAGGATCTAGCAAAATCTATTTTATCTGAAGCAGGCTGGTCAAATTTTCTGTGCAAAGGAAAGAAATTTCATGAGCCTCTGGATCTGGCACTCTTATTCGTTGGTAGAGAGTTACAATCTTCAGATTTAAGCATGAACAAACATGCAAACTCAGCTCTTTTGGACCTGCTCAAGAACTCTTTCGCCAGATCCAACACTTCTGTGGCATTTCCCTATGTTTCTACATCAGAGGATGTGCTTTTGGAAAACTCGTTGGTTTCAGGATTTGCTGAAGCCTGTGGAGATATGGGAATTGGCAATGTTGCTTTCCATGGATCTTGCTCCATTGATGATGCAAATCATGAAGAAATCACAACTTTGCACTCAGTTCAAGACTATTTGACCAAGAGGATGGAAGAGAGTCACAGAGGGAAAACTGATTTGGTTGTGTTCTGCAATGAAGGCTCTCAAGCTCTTGAGAATGTTGACAGGACACAATCTGAAGGGGAAGTTTTATCCAATCTTATCAATTCTGTGGAGGAATCTGGTGCAAAATATGCCATTCTTTATGTGTCAGATCCCTCAAGGTCAATCCAGTATCCTTCTTACAGGGATCTGCAAAGGTTTCTAGCAGAAAGTACAGCCGGGAATGAATCAACCAATTCCACAATTTGTGATGAAGTCTGCCAGATTAAATCATCTCTTCTAGAGGGAATTTTAGTGGTAAATTTCCTTGTCCATTTTTACAAGTGCAGTAGCTCGATGACCTGGTATAGTTTTGCTAATAATTTTGATATCGGGCCTTTGCTGCATGATGGGAATTGA

>Glyma12g02310.10   sequence type=CDS   gene model=Glyma12g02310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGCTGCCGCTATTTACTGCTTTCATTCTCTTTGCTTTTATTCCGAATGGATTGTTAGCAGTTCCTTCCACCGTCCCGGCATTCCTTTGGTCATCACATTATGAACTGGCCTCTGAAAATATATTGAAGGAATCTGTAAATTACCAAGTCATTTCTCCGAAGGATCTAGCAAAATCTATTTTATCTGAAGCAGGCTGGTCAAATTTTCTGTGCAAAGGAAAGAAATTTCATGAGCCTCTGGATCTGGCACTCTTATTCGTTGGTAGAGAGTTACAATCTTCAGATTTAAGCATGAACAAACATGCAAACTCAGCTCTTTTGGACCTGCTCAAGAACTCTTTCGCCAGATCCAACACTTCTGTGGCATTTCCCTATGTTTCTACATCAGAGGATGTGCTTTTGGAAAACTCGTTGGTTTCAGGATTTGCTGAAGCCTGTGGAGATATGGGAATTGGCAATGTTGCTTTCCATGGATCTTGCTCCATTGATGATGCAAATCATGAAGAAATCACAACTTTGCACTCAGTTCAAGACTATTTGACCAAGAGGATGGAAGAGAGTCACAGAGGGAAAACTGATTTGGTTGTGTTCTGCAATGAAGGCTCTCAAGCTCTTGAGAATGTTGACAGGACACAATCTGAAGGGGAAGTTTTATCCAATCTTATCAATTCTGTGGAGGAATCTGGTGCAAAATATGCCATTCTTTATGTGTCAGATCCCTCAAGGTCAATCCAGTATCCTTCTTACAGGGATCTGCAAAGGTTTCTAGCAGAAAGTACAGCCGGGAATGAATCAACCAATTCCACAATTTGTGATGAAGTCTGCCAGATTAAATCATCTCTTCTAGAGGGAATTTTAGTGGGTATAGTTTTGCTAATAATTTTGATATCGGGCCTTTGCTGCATGATGGGAATTGACACCCCAACAAGATTTGAGACGCCACAAGAGTAA

>Glyma12g02310.7   sequence type=CDS   gene model=Glyma12g02310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGCTGCCGCTATTTACTGCTTTCATTCTCTTTGCTTTTATTCCGAATGGATTGTTAGCAGTTCCTTCCACCGTCCCGGCATTCCTTTGGTCATCACATTATGAACTGGCCTCTGAAAATATATTGAAGGAATCTGTAAATTACCAAGTCATTTCTCCGAAGGATCTAGCAAAATCTATTTTATCTGAAGCAGGCTGGTCAAATTTTCTGTGCAAAGGAAAGAAATTTCATGAGCCTCTGGATCTGGCACTCTTATTCGTTGGTAGAGAGTTACAATCTTCAGATTTAAGCATGAACAAACATGCAAACTCAGCTCTTTTGGACCTGCTCAAGAACTCTTTCGCCAGATCCAACACTTCTGTGGCATTTCCCTATGTTTCTACATCAGAGGATGTGCTTTTGGAAAACTCGTTGGTTTCAGGATTTGCTGAAGCCTGTGGAGATATGGGAATTGGCAATGTTGCTTTCCATGGATCTTGCTCCATTGATGATGCAAATCATGAAGAAATCACAACTTTGCACTCAGTTCAAGACTATTTGACCAAGAGGATGGAAGAGAGTCACAGAGGGAAAACTGATTTGGTTGTGTTCTGCAATGAAGGCTCTCAAGCTCTTGAGAATGTTGACAGGACACAATCTGAAGGGGAAGTTTTATCCAATCTTATCAATTCTGTGGAGGAATCTGGTGCAAAATATGCCATTCTTTATGTGTCAGATCCCTCAAGGTCAATCCAGTATCCTTCTTACAGGGATCTGCAAAGGTTTCTAGCAGAAAGTACAGCCGGGAATGAATCAACCAATTCCACAATTTGTGATGAAGTCTGCCAGATTAAATCATCTCTTCTAGAGGGAATTTTAGTGTTCTATGGTACCACAACTATACTCTCGTTGGGCCTGCTTGGGTAG

>Glyma12g02310.8   sequence type=CDS   gene model=Glyma12g02310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGCTGCCGCTATTTACTGCTTTCATTCTCTTTGCTTTTATTCCGAATGGATTGTTAGCAGTTCCTTCCACCGTCCCGGCATTCCTTTGGTCATCACATTATGAACTGGCCTCTGAAAATATATTGAAGGAATCTGTAAATTACCAAGTCATTTCTCCGAAGGATCTAGCAAAATCTATTTTATCTGAAGCAGGCTGGTCAAATTTTCTGTGCAAAGGAAAGAAATTTCATGAGCCTCTGGATCTGGCACTCTTATTCGTTGGTAGAGAGTTACAATCTTCAGATTTAAGCATGAACAAACATGCAAACTCAGCTCTTTTGGACCTGCTCAAGAACTCTTTCGCCAGATCCAACACTTCTGTGGCATTTCCCTATGTTTCTACATCAGAGGATGTGCTTTTGGAAAACTCGTTGGTTTCAGGATTTGCTGAAGCCTGTGGAGATATGGGAATTGGCAATGTTGCTTTCCATGGATCTTGCTCCATTGATGATGCAAATCATGAAGAAATCACAACTTTGCACTCAGTTCAAGACTATTTGACCAAGAGGATGGAAGAGAGTCACAGAGGGAAAACTGATTTGGTTGTGTTCTGCAATGAAGGCTCTCAAGCTCTTGAGAATGTTGACAGGACACAATCTGAAGGGGAAGTTTTATCCAATCTTATCAATTCTGTGGAGGAATCTGGTGCAAAATATGCCATTCTTTATGTGTCAGATCCCTCAAGGTCAATCCAGTATCCTTCTTACAGGGATCTGCAAAGGTTTCTAGCAGAAAGTACAGCCGGGAATGAATCAACCAATTCCACAATTTGTGATGAAGTCTGCCAGATTAAATCATCTCTTCTAGAGGGAATTTTAGTGGGTATAGTTTTGCTAATAATTTTGATATCGGGCCTTTGCTGCATGATGGGAATTGACACCCCAACAAGATTTGAGACGCCACAAGAGTAA

>Glyma12g02310.9   sequence type=CDS   gene model=Glyma12g02310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGCTGCCGCTATTTACTGCTTTCATTCTCTTTGCTTTTATTCCGAATGGATTGTTAGCAGTTCCTTCCACCGTCCCGGCATTCCTTTGGTCATCACATTATGAACTGGCCTCTGAAAATATATTGAAGGAATCTGTAAATTACCAAGTCATTTCTCCGAAGGATCTAGCAAAATCTATTTTATCTGAAGCAGGCTGGTCAAATTTTCTGTGCAAAGGAAAGAAATTTCATGAGCCTCTGGATCTGGCACTCTTATTCGTTGGTAGAGAGTTACAATCTTCAGATTTAAGCATGAACAAACATGCAAACTCAGCTCTTTTGGACCTGCTCAAGAACTCTTTCGCCAGATCCAACACTTCTGTGGCATTTCCCTATGTTTCTACATCAGAGGATGTGCTTTTGGAAAACTCGTTGGTTTCAGGATTTGCTGAAGCCTGTGGAGATATGGGAATTGGCAATGTTGCTTTCCATGGATCTTGCTCCATTGATGATGCAAATCATGAAGAAATCACAACTTTGCACTCAGTTCAAGACTATTTGACCAAGAGGATGGAAGAGAGTCACAGAGGGAAAACTGATTTGGTTGTGTTCTGCAATGAAGGCTCTCAAGCTCTTGAGAATGTTGACAGGACACAATCTGAAGGGGAAGTTTTATCCAATCTTATCAATTCTGTGGAGGAATCTGGTGCAAAATATGCCATTCTTTATGTGTCAGATCCCTCAAGGTCAATCCAGTATCCTTCTTACAGGGATCTGCAAAGGTTTCTAGCAGAAAGTACAGCCGGGAATGAATCAACCAATTCCACAATTTGTGATGAAGTCTGCCAGATTAAATCATCTCTTCTAGAGGGAATTTTAGTGGGTATAGTTTTGCTAATAATTTTGATATCGGGCCTTTGCTGCATGATGGGAATTGACACCCCAACAAGATTTGAGACGCCACAAGAGTAA

>Glyma12g02310.1   sequence type=predicted peptide   gene model=Glyma12g02310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVLPLFTAFILFAFIPNGLLAVPSTVPAFLWSSHYELASENILKESVNYQVISPKDLAKSILSEAGWSNFLCKGKKFHEPLDLALLFVGRELQSSDLSMNKHANSALLDLLKNSFARSNTSVAFPYVSTSEDVLLENSLVSGFAEACGDMGIGNVAFHGSCSIDDANHEEITTLHSVQDYLTKRMEESHRGKTDLVVFCNEGSQALENVDRTQSEGEVLSNLINSVEESGAKYAILYVSDPSRSIQYPSYRDLQRFLAESTAGNESTNSTICDEVCQIKSSLLEGILVVNFLVHFYKCSSSMTWYSFANNFDIGPLLHDGN*

>Glyma12g02310.10   sequence type=predicted peptide   gene model=Glyma12g02310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVLPLFTAFILFAFIPNGLLAVPSTVPAFLWSSHYELASENILKESVNYQVISPKDLAKSILSEAGWSNFLCKGKKFHEPLDLALLFVGRELQSSDLSMNKHANSALLDLLKNSFARSNTSVAFPYVSTSEDVLLENSLVSGFAEACGDMGIGNVAFHGSCSIDDANHEEITTLHSVQDYLTKRMEESHRGKTDLVVFCNEGSQALENVDRTQSEGEVLSNLINSVEESGAKYAILYVSDPSRSIQYPSYRDLQRFLAESTAGNESTNSTICDEVCQIKSSLLEGILVGIVLLIILISGLCCMMGIDTPTRFETPQE*

>Glyma12g02310.7   sequence type=predicted peptide   gene model=Glyma12g02310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVLPLFTAFILFAFIPNGLLAVPSTVPAFLWSSHYELASENILKESVNYQVISPKDLAKSILSEAGWSNFLCKGKKFHEPLDLALLFVGRELQSSDLSMNKHANSALLDLLKNSFARSNTSVAFPYVSTSEDVLLENSLVSGFAEACGDMGIGNVAFHGSCSIDDANHEEITTLHSVQDYLTKRMEESHRGKTDLVVFCNEGSQALENVDRTQSEGEVLSNLINSVEESGAKYAILYVSDPSRSIQYPSYRDLQRFLAESTAGNESTNSTICDEVCQIKSSLLEGILVFYGTTTILSLGLLG*

>Glyma12g02310.8   sequence type=predicted peptide   gene model=Glyma12g02310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVLPLFTAFILFAFIPNGLLAVPSTVPAFLWSSHYELASENILKESVNYQVISPKDLAKSILSEAGWSNFLCKGKKFHEPLDLALLFVGRELQSSDLSMNKHANSALLDLLKNSFARSNTSVAFPYVSTSEDVLLENSLVSGFAEACGDMGIGNVAFHGSCSIDDANHEEITTLHSVQDYLTKRMEESHRGKTDLVVFCNEGSQALENVDRTQSEGEVLSNLINSVEESGAKYAILYVSDPSRSIQYPSYRDLQRFLAESTAGNESTNSTICDEVCQIKSSLLEGILVGIVLLIILISGLCCMMGIDTPTRFETPQE*

>Glyma12g02310.9   sequence type=predicted peptide   gene model=Glyma12g02310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVLPLFTAFILFAFIPNGLLAVPSTVPAFLWSSHYELASENILKESVNYQVISPKDLAKSILSEAGWSNFLCKGKKFHEPLDLALLFVGRELQSSDLSMNKHANSALLDLLKNSFARSNTSVAFPYVSTSEDVLLENSLVSGFAEACGDMGIGNVAFHGSCSIDDANHEEITTLHSVQDYLTKRMEESHRGKTDLVVFCNEGSQALENVDRTQSEGEVLSNLINSVEESGAKYAILYVSDPSRSIQYPSYRDLQRFLAESTAGNESTNSTICDEVCQIKSSLLEGILVGIVLLIILISGLCCMMGIDTPTRFETPQE*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo