SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma18g02210

Feature Type:gene_model
Chromosome:Gm18
Start:1364735
stop:1367733
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G22240AT Annotation by Michelle Graham. TAIR10: myo-inositol-1-phosphate synthase 2 | chr2:9451901-9453938 REVERSE LENGTH=510 SoyBaseE_val: 0ISS
GO:0006021GO-bp Annotation by Michelle Graham. GO Biological Process: inositol biosynthetic process SoyBaseN/AISS
GO:0008654GO-bp Annotation by Michelle Graham. GO Biological Process: phospholipid biosynthetic process SoyBaseN/AISS
GO:0009408GO-bp Annotation by Michelle Graham. GO Biological Process: response to heat SoyBaseN/AISS
GO:0009644GO-bp Annotation by Michelle Graham. GO Biological Process: response to high light intensity SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0010264GO-bp Annotation by Michelle Graham. GO Biological Process: myo-inositol hexakisphosphate biosynthetic process SoyBaseN/AISS
GO:0015996GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll catabolic process SoyBaseN/AISS
GO:0016036GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation SoyBaseN/AISS
GO:0042542GO-bp Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0051607GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to virus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0004512GO-mf Annotation by Michelle Graham. GO Molecular Function: inositol-3-phosphate synthase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG0693 KOG Myo-inositol-1-phosphate synthase JGI ISS
PTHR11510Panther MYO-INOSITOL-1 PHOSPHATE SYNTHASE JGI ISS
PF01658PFAM Myo-inositol-1-phosphate synthase JGI ISS
PF07994PFAM Myo-inositol-1-phosphate synthase JGI ISS
UniRef100_Q2MJR5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Myo-inositol-1-phosphate synthase n=1 Tax=Glycine max RepID=Q2MJR5_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q2MJR5UniRef Annotation by Michelle Graham. Best UniRef hit: Myo-inositol-1-phosphate synthase n=1 Tax=Glycine max RepID=Q2MJR5_SOYBN SoyBaseE_val: 0ISS


View a gene family containing related genes from other legumes at LIS

Gene families from Phytozom1e are displayed using the PhyloTree viewer developed by LIS.


Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g018600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183


Annotation data from JGI Version Wm82.a1.v1.1
FeatureFeature NameChromosomeStartStop
GENEGlyma18g02210 Gm1813647351367733
mRNAGlyma18g02210.1  13647351367733
mRNAGlyma18g02210.2  13647351367733
mRNAGlyma18g02210.3  13647351367733
mRNAGlyma18g02210.4  13647351367733

>Glyma18g02210.1   sequence type=primary transcript   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GCTCGTTCCTCTATATATAGGTCTTCCTTCCCCTGTATTCAGGGGCATCCAACAACCGTTCACAAATCTTTTCTAAGTGTAGAAGAGGAGAGGAACCGCGCCAACCCTCTCTTCTTCTTCTTCTTCAATCCTTTTATAACCTTTATAGTTTCATTCTTAATCGTTGGGAAAAATGTTCATCGAGAATTTTAAGGTAGAGAGTCCTAATGTGAAGTACACCGAGACTGAGATTCAGTCCGTGTACAACTACGAAACCACCGAACTTGTTCACGAGAACAGGAATGGCACCTATCAGTGGATTGTCAAACCCAAATCCGTCAACTACCAATTTAAAACCAACACCCATGTTCCAAAATTGGGGGTGATGCTTGTGGGTTGGGGTGGAAACAACGGCTCTACCCTCACCGGTGGTGTTATTGCTAACAGAGAGGGCATTTCATGGGCTACAAAGGACAAGATTCAACAAGCCAATTACTTTGGCTCCCTCACCCAAGCCTCAGCTATTCGAGTTGGATCCTTCCAGGGAGAGGAAATCTATGCCCCATTCAAGAGTCTGCTTCCAATGGTTAATCCTGACGACATTGTGTTTGGGGGATGGGATATCAGCAACATGAACCTGGCTGATGCCATGGCCAGGGCAAAGGTGTTTGACATCGATTTGCAGAAGCAGTTGAGGCCTTACATGGAATCCATGGTTCCACTCCCCGGAATCTACGACCCGGATTTCATTGCTGCCAACCAAGAGGAGCGTGCCAACAACGTGATTAAGGGCACAAAGCAAGAGCAAGTTCAGCAAATCATCAAAGACATCAAGGCGTTTAAGGAAGCCACCAAAGTGGACAAGGTGGTTGTCCTGTGGACTGCCAACACAGAGAGGTATAGCAATTTGGTTGTAGGCCTTAATGACACCATGGAGAATCTCTTGGCTGCTGTGGACAGAAATGAGGCTGAGATTTCTCCTTCCACCTTGTATGCCATTGCCTGTGTGATGGAAAATGTTCCTTTCATTAATGGAAGCCCTCAGAACACTTTTGTACCAGGGCTGATTGATCTTGCCATCGCGAGGAACACTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGACCAAAATGAAATCTGTGTTGGTTGATTTTCTTGTGGGGGCTGGTATCAAGCCAACATCTATAGTTAGTTACAACCATCTGGGAAACAATGATGGTATGAATCTCTCGGCTCCACAAACCTTCCGCTCCAAGGAAATCTCCAAGAGCAACGTTGTTGACGATATGGTCAACAGCAATGCCATCCTCTATGAGCCTGGTGAACATCCCGACCATGTTGTTGTTATTAAGTATGTGCCTTACGTAGGGGATAGCAAGAGAGCCATGGATGAGTACACTTCAGAGATATTCATGGGTGGAAAGAACACCATTGTTTTGCACAACACATGTGAGGATTCCCTTTTAGCTGCTCCTATTATCTTGGACTTGGTCCTTCTTGCTGAGCTGAGCACTAGAATCCAGTTTAAAGCTGAAAATGAGGGAAAATTCCACTCATTCCACCCAGTTGCTACCATTCTCAGCTATCTGACCAAGGCTCCTCTGGTTCCACCGGGTACACCAGTGGTGAATGCATTGTCAAAGCAGCGTGCAATGCTGGAAAACATAATGAGGGCTTGTGTTGGATTGGCCCCAGAGAATAACATGATTCTCGAGTACAAGTGACGCATGGGATAGAATAATAATTTTGTTGGGGTAGCCTATCCGAATGGTTTATGTTAATAATATGTTTGCTTATGATTTTGCAAGTGTAATTGATTGCATCTTCTCATTAATGCTTTAGAGCAGGACATATTCTGTTTTCTAGGGACATGAATGAATGTAGTATAATTTTGTGTACTTTATCCTCTTACCCTTCTCCATTTTTAGTATATTTTTTAGTT

>Glyma18g02210.1   sequence type=CDS   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTCATCGAGAATTTTAAGGTAGAGAGTCCTAATGTGAAGTACACCGAGACTGAGATTCAGTCCGTGTACAACTACGAAACCACCGAACTTGTTCACGAGAACAGGAATGGCACCTATCAGTGGATTGTCAAACCCAAATCCGTCAACTACCAATTTAAAACCAACACCCATGTTCCAAAATTGGGGGTGATGCTTGTGGGTTGGGGTGGAAACAACGGCTCTACCCTCACCGGTGGTGTTATTGCTAACAGAGAGGGCATTTCATGGGCTACAAAGGACAAGATTCAACAAGCCAATTACTTTGGCTCCCTCACCCAAGCCTCAGCTATTCGAGTTGGATCCTTCCAGGGAGAGGAAATCTATGCCCCATTCAAGAGTCTGCTTCCAATGGTTAATCCTGACGACATTGTGTTTGGGGGATGGGATATCAGCAACATGAACCTGGCTGATGCCATGGCCAGGGCAAAGGTGTTTGACATCGATTTGCAGAAGCAGTTGAGGCCTTACATGGAATCCATGGTTCCACTCCCCGGAATCTACGACCCGGATTTCATTGCTGCCAACCAAGAGGAGCGTGCCAACAACGTGATTAAGGGCACAAAGCAAGAGCAAGTTCAGCAAATCATCAAAGACATCAAGGCGTTTAAGGAAGCCACCAAAGTGGACAAGGTGGTTGTCCTGTGGACTGCCAACACAGAGAGGTATAGCAATTTGGTTGTAGGCCTTAATGACACCATGGAGAATCTCTTGGCTGCTGTGGACAGAAATGAGGCTGAGATTTCTCCTTCCACCTTGTATGCCATTGCCTGTGTGATGGAAAATGTTCCTTTCATTAATGGAAGCCCTCAGAACACTTTTGTACCAGGGCTGATTGATCTTGCCATCGCGAGGAACACTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGACCAAAATGAAATCTGTGTTGGTTGATTTTCTTGTGGGGGCTGGTATCAAGCCAACATCTATAGTTAGTTACAACCATCTGGGAAACAATGATGGTATGAATCTCTCGGCTCCACAAACCTTCCGCTCCAAGGAAATCTCCAAGAGCAACGTTGTTGACGATATGGTCAACAGCAATGCCATCCTCTATGAGCCTGGTGAACATCCCGACCATGTTGTTGTTATTAAGTATGTGCCTTACGTAGGGGATAGCAAGAGAGCCATGGATGAGTACACTTCAGAGATATTCATGGGTGGAAAGAACACCATTGTTTTGCACAACACATGTGAGGATTCCCTTTTAGCTGCTCCTATTATCTTGGACTTGGTCCTTCTTGCTGAGCTGAGCACTAGAATCCAGTTTAAAGCTGAAAATGAGGGAAAATTCCACTCATTCCACCCAGTTGCTACCATTCTCAGCTATCTGACCAAGGCTCCTCTGGTTCCACCGGGTACACCAGTGGTGAATGCATTGTCAAAGCAGCGTGCAATGCTGGAAAACATAATGAGGGCTTGTGTTGGATTGGCCCCAGAGAATAACATGATTCTCGAGTACAAGTGA

>Glyma18g02210.2   sequence type=CDS   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTCATCGAGAATTTTAAGGTAGAGAGTCCTAATGTGAAGTACACCGAGACTGAGATTCAGTCCGTGTACAACTACGAAACCACCGAACTTGTTCACGAGAACAGGAATGGCACCTATCAGTGGATTGTCAAACCCAAATCCGTCAACTACCAATTTAAAACCAACACCCATGTTCCAAAATTGGGGGTGATGCTTGTGGGTTGGGGTGGAAACAACGGCTCTACCCTCACCGGTGGTGTTATTGCTAACAGAGAGGGCATTTCATGGGCTACAAAGGACAAGATTCAACAAGCCAATTACTTTGGCTCCCTCACCCAAGCCTCAGCTATTCGAGTTGGATCCTTCCAGGGAGAGGAAATCTATGCCCCATTCAAGAGTCTGCTTCCAATGGTTAATCCTGACGACATTGTGTTTGGGGGATGGGATATCAGCAACATGAACCTGGCTGATGCCATGGCCAGGGCAAAGGTGTTTGACATCGATTTGCAGAAGCAGTTGAGGCCTTACATGGAATCCATGGTTCCACTCCCCGGAATCTACGACCCGGATTTCATTGCTGCCAACCAAGAGGAGCGTGCCAACAACGTGATTAAGGGCACAAAGCAAGAGCAAGTTCAGCAAATCATCAAAGACATCAAGGCGTTTAAGGAAGCCACCAAAGTGGACAAGGTGGTTGTCCTGTGGACTGCCAACACAGAGAGGTATAGCAATTTGGTTGTAGGCCTTAATGACACCATGGAGAATCTCTTGGCTGCTGTGGACAGAAATGAGGCTGAGATTTCTCCTTCCACCTTGTATGCCATTGCCTGTGTGATGGAAAATGTTCCTTTCATTAATGGAAGCCCTCAGAACACTTTTGTACCAGGGCTGATTGATCTTGCCATCGCGAGGAACACTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGACCAAAATGAAATCTGTGTTGGTTGATTTTCTTGTGGGGGCTGGTATCAAGGTACATTGTTGTTATACTAATGTCATATCATGGGTGTTATTTTTACTAGGACAATCTATCCTTTGCATGTTTTGTAAACAATTTATGCATCGTGCTAGATTTATATGTCAAAAATGGAGAAATGAGTTGATTTTTTCAAGTGTTCTGTTGATGATTGACAGCCAACATCTATAG

>Glyma18g02210.3   sequence type=CDS   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTCATCGAGAATTTTAAGGTAGAGAGTCCTAATGTGAAGTACACCGAGACTGAGATTCAGTCCGTGTACAACTACGAAACCACCGAACTTGTTCACGAGAACAGGAATGGCACCTATCAGTGGATTGTCAAACCCAAATCCGTCAACTACCAATTTAAAACCAACACCCATGTTCCAAAATTGGGGGTGATGCTTGTGGGTTGGGGTGGAAACAACGGCTCTACCCTCACCGGTGGTGTTATTGCTAACAGAGAGGGCATTTCATGGGCTACAAAGGACAAGATTCAACAAGCCAATTACTTTGGCTCCCTCACCCAAGCCTCAGCTATTCGAGTTGGATCCTTCCAGGGAGAGGAAATCTATGCCCCATTCAAGAGTCTGCTTCCAATGGTTAATCCTGACGACATTGTGTTTGGGGGATGGGATATCAGCAACATGAACCTGGCTGATGCCATGGCCAGGGCAAAGGTGTTTGACATCGATTTGCAGAAGCAGTTGAGGCCTTACATGGAATCCATGGTTCCACTCCCCGGAATCTACGACCCGGATTTCATTGCTGCCAACCAAGAGGAGCGTGCCAACAACGTGATTAAGGGCACAAAGCAAGAGCAAGTTCAGCAAATCATCAAAGACATCAAGGCGTTTAAGGAAGCCACCAAAGTGGACAAGGTGGTTGTCCTGTGGACTGCCAACACAGAGAGGTATAGCAATTTGGTTGTAGGCCTTAATGACACCATGGAGAATCTCTTGGCTGCTGTGGACAGAAATGAGGCTGAGATTTCTCCTTCCACCTTGTATGCCATTGCCTGTGTGATGGAAAATGTTCCTTTCATTAATGGAAGCCCTCAGAACACTTTTGTACCAGGGCTGATTGATCTTGCCATCGCGAGGAACACTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGACCAAAATGAAATCTGTGTTGGTTGATTTTCTTGTGGGGGCTGGTATCAAGCCAACATCTATAGTTAGTTACAACCATCTGGGAAACAATGATGGTATGAATCTCTCGGCTCCACAAACCTTCCGCTCCAAGGAAATCTCCAAGAGCAACGTTGTTGACGATATGGTCAACAGCAATGCCATCCTCTATGAGCCTGGTCTTTGA

>Glyma18g02210.4   sequence type=CDS   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTCATCGAGAATTTTAAGGTAGAGAGTCCTAATGTGAAGTACACCGAGACTGAGATTCAGTCCGTGTACAACTACGAAACCACCGAACTTGTTCACGAGAACAGGAATGGCACCTATCAGTGGATTGTCAAACCCAAATCCGTCAACTACCAATTTAAAACCAACACCCATGTTCCAAAATTGGGGGTGATGCTTGTGGGTTGGGGTGGAAACAACGGCTCTACCCTCACCGGTGGTGTTATTGCTAACAGAGAGGGCATTTCATGGGCTACAAAGGACAAGATTCAACAAGCCAATTACTTTGGCTCCCTCACCCAAGCCTCAGCTATTCGAGTTGGATCCTTCCAGGGAGAGGAAATCTATGCCCCATTCAAGAGTCTGCTTCCAATGGTTAATCCTGACGACATTGTGTTTGGGGGATGGGATATCAGCAACATGAACCTGGCTGATGCCATGGCCAGGGCAAAGGTGTTTGACATCGATTTGCAGAAGCAGTTGAGGCCTTACATGGAATCCATGGTTCCACTCCCCGGAATCTACGACCCGGATTTCATTGCTGCCAACCAAGAGGAGCGTGCCAACAACGTGATTAAGGGCACAAAGCAAGAGCAAGTTCAGCAAATCATCAAAGACATCAAGGCGTTTAAGGAAGCCACCAAAGTGGACAAGGTGGTTGTCCTGTGGACTGCCAACACAGAGAGGTATAGCAATTTGGTTGTAGGCCTTAATGACACCATGGAGAATCTCTTGGCTGCTGTGGACAGAAATGAGGCTGAGATTTCTCCTTCCACCTTGTATGCCATTGCCTGTGTGATGGAAAATGTTCCTTTCATTAATGGAAGCCCTCAGAACACTTTTGTACCAGGGCTGATTGATCTTGCCATCGCGAGGAACACTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGACCAAAATGAAATCTGTGTTGGTTGATTTTCTTGTGGGGGCTGGTATCAAGCCAACATCTATAGTTAGTTACAACCATCTGGGAAACAATGATGGTATGAATCTCTCGGCTCCACAAACCTTCCGCTCCAAGGAAATCTCCAAGAGCAACGTTGTTGACGATATGGTCAACAGCAATGCCATCCTCTATGAGCCTGGTGAACATCCCGACCATGTTGTTGTTATTAAGTATGTGCCTTACGTAGGGGATAGCAAGAGAGCCATGGATGAGTACACTTCAGAGATATTCATGGGTGGAAAGAACACCATTGTTTTGCACAACACATGTGAGGATTCCCTTTTAGCTGCTCCTATTATCTTGGACTTGGTCCTTCTTGCTGAGCTGAGCACTAGAATCCAGTTTAAAGCTGAAAATGAGGTCTGCATGCATTGCTAA

>Glyma18g02210.1   sequence type=predicted peptide   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFIENFKVESPNVKYTETEIQSVYNYETTELVHENRNGTYQWIVKPKSVNYQFKTNTHVPKLGVMLVGWGGNNGSTLTGGVIANREGISWATKDKIQQANYFGSLTQASAIRVGSFQGEEIYAPFKSLLPMVNPDDIVFGGWDISNMNLADAMARAKVFDIDLQKQLRPYMESMVPLPGIYDPDFIAANQEERANNVIKGTKQEQVQQIIKDIKAFKEATKVDKVVVLWTANTERYSNLVVGLNDTMENLLAAVDRNEAEISPSTLYAIACVMENVPFINGSPQNTFVPGLIDLAIARNTLIGGDDFKSGQTKMKSVLVDFLVGAGIKPTSIVSYNHLGNNDGMNLSAPQTFRSKEISKSNVVDDMVNSNAILYEPGEHPDHVVVIKYVPYVGDSKRAMDEYTSEIFMGGKNTIVLHNTCEDSLLAAPIILDLVLLAELSTRIQFKAENEGKFHSFHPVATILSYLTKAPLVPPGTPVVNALSKQRAMLENIMRACVGLAPENNMILEYK*

>Glyma18g02210.2   sequence type=predicted peptide   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFIENFKVESPNVKYTETEIQSVYNYETTELVHENRNGTYQWIVKPKSVNYQFKTNTHVPKLGVMLVGWGGNNGSTLTGGVIANREGISWATKDKIQQANYFGSLTQASAIRVGSFQGEEIYAPFKSLLPMVNPDDIVFGGWDISNMNLADAMARAKVFDIDLQKQLRPYMESMVPLPGIYDPDFIAANQEERANNVIKGTKQEQVQQIIKDIKAFKEATKVDKVVVLWTANTERYSNLVVGLNDTMENLLAAVDRNEAEISPSTLYAIACVMENVPFINGSPQNTFVPGLIDLAIARNTLIGGDDFKSGQTKMKSVLVDFLVGAGIKVHCCYTNVISWVLFLLGQSILCMFCKQFMHRARFICQKWRNELIFSSVLLMIDSQHL*

>Glyma18g02210.3   sequence type=predicted peptide   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFIENFKVESPNVKYTETEIQSVYNYETTELVHENRNGTYQWIVKPKSVNYQFKTNTHVPKLGVMLVGWGGNNGSTLTGGVIANREGISWATKDKIQQANYFGSLTQASAIRVGSFQGEEIYAPFKSLLPMVNPDDIVFGGWDISNMNLADAMARAKVFDIDLQKQLRPYMESMVPLPGIYDPDFIAANQEERANNVIKGTKQEQVQQIIKDIKAFKEATKVDKVVVLWTANTERYSNLVVGLNDTMENLLAAVDRNEAEISPSTLYAIACVMENVPFINGSPQNTFVPGLIDLAIARNTLIGGDDFKSGQTKMKSVLVDFLVGAGIKPTSIVSYNHLGNNDGMNLSAPQTFRSKEISKSNVVDDMVNSNAILYEPGL*

>Glyma18g02210.4   sequence type=predicted peptide   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFIENFKVESPNVKYTETEIQSVYNYETTELVHENRNGTYQWIVKPKSVNYQFKTNTHVPKLGVMLVGWGGNNGSTLTGGVIANREGISWATKDKIQQANYFGSLTQASAIRVGSFQGEEIYAPFKSLLPMVNPDDIVFGGWDISNMNLADAMARAKVFDIDLQKQLRPYMESMVPLPGIYDPDFIAANQEERANNVIKGTKQEQVQQIIKDIKAFKEATKVDKVVVLWTANTERYSNLVVGLNDTMENLLAAVDRNEAEISPSTLYAIACVMENVPFINGSPQNTFVPGLIDLAIARNTLIGGDDFKSGQTKMKSVLVDFLVGAGIKPTSIVSYNHLGNNDGMNLSAPQTFRSKEISKSNVVDDMVNSNAILYEPGEHPDHVVVIKYVPYVGDSKRAMDEYTSEIFMGGKNTIVLHNTCEDSLLAAPIILDLVLLAELSTRIQFKAENEVCMHC*







USDA Logo
Iowa State University Logo