SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma18g02210

Feature Type:gene_model
Chromosome:Gm18
Start:1364735
stop:1367733
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G22240AT Annotation by Michelle Graham. TAIR10: myo-inositol-1-phosphate synthase 2 | chr2:9451901-9453938 REVERSE LENGTH=510 SoyBaseE_val: 0ISS
GO:0006021GO-bp Annotation by Michelle Graham. GO Biological Process: inositol biosynthetic process SoyBaseN/AISS
GO:0008654GO-bp Annotation by Michelle Graham. GO Biological Process: phospholipid biosynthetic process SoyBaseN/AISS
GO:0009408GO-bp Annotation by Michelle Graham. GO Biological Process: response to heat SoyBaseN/AISS
GO:0009644GO-bp Annotation by Michelle Graham. GO Biological Process: response to high light intensity SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0010264GO-bp Annotation by Michelle Graham. GO Biological Process: myo-inositol hexakisphosphate biosynthetic process SoyBaseN/AISS
GO:0015996GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll catabolic process SoyBaseN/AISS
GO:0016036GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation SoyBaseN/AISS
GO:0042542GO-bp Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0051607GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to virus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0004512GO-mf Annotation by Michelle Graham. GO Molecular Function: inositol-3-phosphate synthase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG0693 KOG Myo-inositol-1-phosphate synthase JGI ISS
PTHR11510Panther MYO-INOSITOL-1 PHOSPHATE SYNTHASE JGI ISS
PF01658PFAM Myo-inositol-1-phosphate synthase JGI ISS
PF07994PFAM Myo-inositol-1-phosphate synthase JGI ISS
UniRef100_Q2MJR5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Myo-inositol-1-phosphate synthase n=1 Tax=Glycine max RepID=Q2MJR5_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q2MJR5UniRef Annotation by Michelle Graham. Best UniRef hit: Myo-inositol-1-phosphate synthase n=1 Tax=Glycine max RepID=Q2MJR5_SOYBN SoyBaseE_val: 0ISS

Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g018600 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183


Annotation data from JGI Version Wm82.a1.v1.1
FeatureFeature NameChromosomeStartStop
GENEGlyma18g02210 Gm1813647351367733
mRNAGlyma18g02210.1  13647351367733
mRNAGlyma18g02210.2  13647351367733
mRNAGlyma18g02210.3  13647351367733
mRNAGlyma18g02210.4  13647351367733

>Glyma18g02210.1   sequence type=primary transcript   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GCTCGTTCCTCTATATATAGGTCTTCCTTCCCCTGTATTCAGGGGCATCCAACAACCGTTCACAAATCTTTTCTAAGTGTAGAAGAGGAGAGGAACCGCGCCAACCCTCTCTTCTTCTTCTTCTTCAATCCTTTTATAACCTTTATAGTTTCATTCTTAATCGTTGGGAAAAATGTTCATCGAGAATTTTAAGGTAGAGAGTCCTAATGTGAAGTACACCGAGACTGAGATTCAGTCCGTGTACAACTACGAAACCACCGAACTTGTTCACGAGAACAGGAATGGCACCTATCAGTGGATTGTCAAACCCAAATCCGTCAACTACCAATTTAAAACCAACACCCATGTTCCAAAATTGGGGGTGATGCTTGTGGGTTGGGGTGGAAACAACGGCTCTACCCTCACCGGTGGTGTTATTGCTAACAGAGAGGGCATTTCATGGGCTACAAAGGACAAGATTCAACAAGCCAATTACTTTGGCTCCCTCACCCAAGCCTCAGCTATTCGAGTTGGATCCTTCCAGGGAGAGGAAATCTATGCCCCATTCAAGAGTCTGCTTCCAATGGTTAATCCTGACGACATTGTGTTTGGGGGATGGGATATCAGCAACATGAACCTGGCTGATGCCATGGCCAGGGCAAAGGTGTTTGACATCGATTTGCAGAAGCAGTTGAGGCCTTACATGGAATCCATGGTTCCACTCCCCGGAATCTACGACCCGGATTTCATTGCTGCCAACCAAGAGGAGCGTGCCAACAACGTGATTAAGGGCACAAAGCAAGAGCAAGTTCAGCAAATCATCAAAGACATCAAGGCGTTTAAGGAAGCCACCAAAGTGGACAAGGTGGTTGTCCTGTGGACTGCCAACACAGAGAGGTATAGCAATTTGGTTGTAGGCCTTAATGACACCATGGAGAATCTCTTGGCTGCTGTGGACAGAAATGAGGCTGAGATTTCTCCTTCCACCTTGTATGCCATTGCCTGTGTGATGGAAAATGTTCCTTTCATTAATGGAAGCCCTCAGAACACTTTTGTACCAGGGCTGATTGATCTTGCCATCGCGAGGAACACTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGACCAAAATGAAATCTGTGTTGGTTGATTTTCTTGTGGGGGCTGGTATCAAGCCAACATCTATAGTTAGTTACAACCATCTGGGAAACAATGATGGTATGAATCTCTCGGCTCCACAAACCTTCCGCTCCAAGGAAATCTCCAAGAGCAACGTTGTTGACGATATGGTCAACAGCAATGCCATCCTCTATGAGCCTGGTGAACATCCCGACCATGTTGTTGTTATTAAGTATGTGCCTTACGTAGGGGATAGCAAGAGAGCCATGGATGAGTACACTTCAGAGATATTCATGGGTGGAAAGAACACCATTGTTTTGCACAACACATGTGAGGATTCCCTTTTAGCTGCTCCTATTATCTTGGACTTGGTCCTTCTTGCTGAGCTGAGCACTAGAATCCAGTTTAAAGCTGAAAATGAGGGAAAATTCCACTCATTCCACCCAGTTGCTACCATTCTCAGCTATCTGACCAAGGCTCCTCTGGTTCCACCGGGTACACCAGTGGTGAATGCATTGTCAAAGCAGCGTGCAATGCTGGAAAACATAATGAGGGCTTGTGTTGGATTGGCCCCAGAGAATAACATGATTCTCGAGTACAAGTGACGCATGGGATAGAATAATAATTTTGTTGGGGTAGCCTATCCGAATGGTTTATGTTAATAATATGTTTGCTTATGATTTTGCAAGTGTAATTGATTGCATCTTCTCATTAATGCTTTAGAGCAGGACATATTCTGTTTTCTAGGGACATGAATGAATGTAGTATAATTTTGTGTACTTTATCCTCTTACCCTTCTCCATTTTTAGTATATTTTTTAGTT

>Glyma18g02210.1   sequence type=CDS   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTCATCGAGAATTTTAAGGTAGAGAGTCCTAATGTGAAGTACACCGAGACTGAGATTCAGTCCGTGTACAACTACGAAACCACCGAACTTGTTCACGAGAACAGGAATGGCACCTATCAGTGGATTGTCAAACCCAAATCCGTCAACTACCAATTTAAAACCAACACCCATGTTCCAAAATTGGGGGTGATGCTTGTGGGTTGGGGTGGAAACAACGGCTCTACCCTCACCGGTGGTGTTATTGCTAACAGAGAGGGCATTTCATGGGCTACAAAGGACAAGATTCAACAAGCCAATTACTTTGGCTCCCTCACCCAAGCCTCAGCTATTCGAGTTGGATCCTTCCAGGGAGAGGAAATCTATGCCCCATTCAAGAGTCTGCTTCCAATGGTTAATCCTGACGACATTGTGTTTGGGGGATGGGATATCAGCAACATGAACCTGGCTGATGCCATGGCCAGGGCAAAGGTGTTTGACATCGATTTGCAGAAGCAGTTGAGGCCTTACATGGAATCCATGGTTCCACTCCCCGGAATCTACGACCCGGATTTCATTGCTGCCAACCAAGAGGAGCGTGCCAACAACGTGATTAAGGGCACAAAGCAAGAGCAAGTTCAGCAAATCATCAAAGACATCAAGGCGTTTAAGGAAGCCACCAAAGTGGACAAGGTGGTTGTCCTGTGGACTGCCAACACAGAGAGGTATAGCAATTTGGTTGTAGGCCTTAATGACACCATGGAGAATCTCTTGGCTGCTGTGGACAGAAATGAGGCTGAGATTTCTCCTTCCACCTTGTATGCCATTGCCTGTGTGATGGAAAATGTTCCTTTCATTAATGGAAGCCCTCAGAACACTTTTGTACCAGGGCTGATTGATCTTGCCATCGCGAGGAACACTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGACCAAAATGAAATCTGTGTTGGTTGATTTTCTTGTGGGGGCTGGTATCAAGCCAACATCTATAGTTAGTTACAACCATCTGGGAAACAATGATGGTATGAATCTCTCGGCTCCACAAACCTTCCGCTCCAAGGAAATCTCCAAGAGCAACGTTGTTGACGATATGGTCAACAGCAATGCCATCCTCTATGAGCCTGGTGAACATCCCGACCATGTTGTTGTTATTAAGTATGTGCCTTACGTAGGGGATAGCAAGAGAGCCATGGATGAGTACACTTCAGAGATATTCATGGGTGGAAAGAACACCATTGTTTTGCACAACACATGTGAGGATTCCCTTTTAGCTGCTCCTATTATCTTGGACTTGGTCCTTCTTGCTGAGCTGAGCACTAGAATCCAGTTTAAAGCTGAAAATGAGGGAAAATTCCACTCATTCCACCCAGTTGCTACCATTCTCAGCTATCTGACCAAGGCTCCTCTGGTTCCACCGGGTACACCAGTGGTGAATGCATTGTCAAAGCAGCGTGCAATGCTGGAAAACATAATGAGGGCTTGTGTTGGATTGGCCCCAGAGAATAACATGATTCTCGAGTACAAGTGA

>Glyma18g02210.2   sequence type=CDS   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTCATCGAGAATTTTAAGGTAGAGAGTCCTAATGTGAAGTACACCGAGACTGAGATTCAGTCCGTGTACAACTACGAAACCACCGAACTTGTTCACGAGAACAGGAATGGCACCTATCAGTGGATTGTCAAACCCAAATCCGTCAACTACCAATTTAAAACCAACACCCATGTTCCAAAATTGGGGGTGATGCTTGTGGGTTGGGGTGGAAACAACGGCTCTACCCTCACCGGTGGTGTTATTGCTAACAGAGAGGGCATTTCATGGGCTACAAAGGACAAGATTCAACAAGCCAATTACTTTGGCTCCCTCACCCAAGCCTCAGCTATTCGAGTTGGATCCTTCCAGGGAGAGGAAATCTATGCCCCATTCAAGAGTCTGCTTCCAATGGTTAATCCTGACGACATTGTGTTTGGGGGATGGGATATCAGCAACATGAACCTGGCTGATGCCATGGCCAGGGCAAAGGTGTTTGACATCGATTTGCAGAAGCAGTTGAGGCCTTACATGGAATCCATGGTTCCACTCCCCGGAATCTACGACCCGGATTTCATTGCTGCCAACCAAGAGGAGCGTGCCAACAACGTGATTAAGGGCACAAAGCAAGAGCAAGTTCAGCAAATCATCAAAGACATCAAGGCGTTTAAGGAAGCCACCAAAGTGGACAAGGTGGTTGTCCTGTGGACTGCCAACACAGAGAGGTATAGCAATTTGGTTGTAGGCCTTAATGACACCATGGAGAATCTCTTGGCTGCTGTGGACAGAAATGAGGCTGAGATTTCTCCTTCCACCTTGTATGCCATTGCCTGTGTGATGGAAAATGTTCCTTTCATTAATGGAAGCCCTCAGAACACTTTTGTACCAGGGCTGATTGATCTTGCCATCGCGAGGAACACTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGACCAAAATGAAATCTGTGTTGGTTGATTTTCTTGTGGGGGCTGGTATCAAGGTACATTGTTGTTATACTAATGTCATATCATGGGTGTTATTTTTACTAGGACAATCTATCCTTTGCATGTTTTGTAAACAATTTATGCATCGTGCTAGATTTATATGTCAAAAATGGAGAAATGAGTTGATTTTTTCAAGTGTTCTGTTGATGATTGACAGCCAACATCTATAG

>Glyma18g02210.3   sequence type=CDS   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTCATCGAGAATTTTAAGGTAGAGAGTCCTAATGTGAAGTACACCGAGACTGAGATTCAGTCCGTGTACAACTACGAAACCACCGAACTTGTTCACGAGAACAGGAATGGCACCTATCAGTGGATTGTCAAACCCAAATCCGTCAACTACCAATTTAAAACCAACACCCATGTTCCAAAATTGGGGGTGATGCTTGTGGGTTGGGGTGGAAACAACGGCTCTACCCTCACCGGTGGTGTTATTGCTAACAGAGAGGGCATTTCATGGGCTACAAAGGACAAGATTCAACAAGCCAATTACTTTGGCTCCCTCACCCAAGCCTCAGCTATTCGAGTTGGATCCTTCCAGGGAGAGGAAATCTATGCCCCATTCAAGAGTCTGCTTCCAATGGTTAATCCTGACGACATTGTGTTTGGGGGATGGGATATCAGCAACATGAACCTGGCTGATGCCATGGCCAGGGCAAAGGTGTTTGACATCGATTTGCAGAAGCAGTTGAGGCCTTACATGGAATCCATGGTTCCACTCCCCGGAATCTACGACCCGGATTTCATTGCTGCCAACCAAGAGGAGCGTGCCAACAACGTGATTAAGGGCACAAAGCAAGAGCAAGTTCAGCAAATCATCAAAGACATCAAGGCGTTTAAGGAAGCCACCAAAGTGGACAAGGTGGTTGTCCTGTGGACTGCCAACACAGAGAGGTATAGCAATTTGGTTGTAGGCCTTAATGACACCATGGAGAATCTCTTGGCTGCTGTGGACAGAAATGAGGCTGAGATTTCTCCTTCCACCTTGTATGCCATTGCCTGTGTGATGGAAAATGTTCCTTTCATTAATGGAAGCCCTCAGAACACTTTTGTACCAGGGCTGATTGATCTTGCCATCGCGAGGAACACTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGACCAAAATGAAATCTGTGTTGGTTGATTTTCTTGTGGGGGCTGGTATCAAGCCAACATCTATAGTTAGTTACAACCATCTGGGAAACAATGATGGTATGAATCTCTCGGCTCCACAAACCTTCCGCTCCAAGGAAATCTCCAAGAGCAACGTTGTTGACGATATGGTCAACAGCAATGCCATCCTCTATGAGCCTGGTCTTTGA

>Glyma18g02210.4   sequence type=CDS   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTCATCGAGAATTTTAAGGTAGAGAGTCCTAATGTGAAGTACACCGAGACTGAGATTCAGTCCGTGTACAACTACGAAACCACCGAACTTGTTCACGAGAACAGGAATGGCACCTATCAGTGGATTGTCAAACCCAAATCCGTCAACTACCAATTTAAAACCAACACCCATGTTCCAAAATTGGGGGTGATGCTTGTGGGTTGGGGTGGAAACAACGGCTCTACCCTCACCGGTGGTGTTATTGCTAACAGAGAGGGCATTTCATGGGCTACAAAGGACAAGATTCAACAAGCCAATTACTTTGGCTCCCTCACCCAAGCCTCAGCTATTCGAGTTGGATCCTTCCAGGGAGAGGAAATCTATGCCCCATTCAAGAGTCTGCTTCCAATGGTTAATCCTGACGACATTGTGTTTGGGGGATGGGATATCAGCAACATGAACCTGGCTGATGCCATGGCCAGGGCAAAGGTGTTTGACATCGATTTGCAGAAGCAGTTGAGGCCTTACATGGAATCCATGGTTCCACTCCCCGGAATCTACGACCCGGATTTCATTGCTGCCAACCAAGAGGAGCGTGCCAACAACGTGATTAAGGGCACAAAGCAAGAGCAAGTTCAGCAAATCATCAAAGACATCAAGGCGTTTAAGGAAGCCACCAAAGTGGACAAGGTGGTTGTCCTGTGGACTGCCAACACAGAGAGGTATAGCAATTTGGTTGTAGGCCTTAATGACACCATGGAGAATCTCTTGGCTGCTGTGGACAGAAATGAGGCTGAGATTTCTCCTTCCACCTTGTATGCCATTGCCTGTGTGATGGAAAATGTTCCTTTCATTAATGGAAGCCCTCAGAACACTTTTGTACCAGGGCTGATTGATCTTGCCATCGCGAGGAACACTTTGATTGGTGGAGATGACTTCAAGAGTGGTCAGACCAAAATGAAATCTGTGTTGGTTGATTTTCTTGTGGGGGCTGGTATCAAGCCAACATCTATAGTTAGTTACAACCATCTGGGAAACAATGATGGTATGAATCTCTCGGCTCCACAAACCTTCCGCTCCAAGGAAATCTCCAAGAGCAACGTTGTTGACGATATGGTCAACAGCAATGCCATCCTCTATGAGCCTGGTGAACATCCCGACCATGTTGTTGTTATTAAGTATGTGCCTTACGTAGGGGATAGCAAGAGAGCCATGGATGAGTACACTTCAGAGATATTCATGGGTGGAAAGAACACCATTGTTTTGCACAACACATGTGAGGATTCCCTTTTAGCTGCTCCTATTATCTTGGACTTGGTCCTTCTTGCTGAGCTGAGCACTAGAATCCAGTTTAAAGCTGAAAATGAGGTCTGCATGCATTGCTAA

>Glyma18g02210.1   sequence type=predicted peptide   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFIENFKVESPNVKYTETEIQSVYNYETTELVHENRNGTYQWIVKPKSVNYQFKTNTHVPKLGVMLVGWGGNNGSTLTGGVIANREGISWATKDKIQQANYFGSLTQASAIRVGSFQGEEIYAPFKSLLPMVNPDDIVFGGWDISNMNLADAMARAKVFDIDLQKQLRPYMESMVPLPGIYDPDFIAANQEERANNVIKGTKQEQVQQIIKDIKAFKEATKVDKVVVLWTANTERYSNLVVGLNDTMENLLAAVDRNEAEISPSTLYAIACVMENVPFINGSPQNTFVPGLIDLAIARNTLIGGDDFKSGQTKMKSVLVDFLVGAGIKPTSIVSYNHLGNNDGMNLSAPQTFRSKEISKSNVVDDMVNSNAILYEPGEHPDHVVVIKYVPYVGDSKRAMDEYTSEIFMGGKNTIVLHNTCEDSLLAAPIILDLVLLAELSTRIQFKAENEGKFHSFHPVATILSYLTKAPLVPPGTPVVNALSKQRAMLENIMRACVGLAPENNMILEYK*

>Glyma18g02210.2   sequence type=predicted peptide   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFIENFKVESPNVKYTETEIQSVYNYETTELVHENRNGTYQWIVKPKSVNYQFKTNTHVPKLGVMLVGWGGNNGSTLTGGVIANREGISWATKDKIQQANYFGSLTQASAIRVGSFQGEEIYAPFKSLLPMVNPDDIVFGGWDISNMNLADAMARAKVFDIDLQKQLRPYMESMVPLPGIYDPDFIAANQEERANNVIKGTKQEQVQQIIKDIKAFKEATKVDKVVVLWTANTERYSNLVVGLNDTMENLLAAVDRNEAEISPSTLYAIACVMENVPFINGSPQNTFVPGLIDLAIARNTLIGGDDFKSGQTKMKSVLVDFLVGAGIKVHCCYTNVISWVLFLLGQSILCMFCKQFMHRARFICQKWRNELIFSSVLLMIDSQHL*

>Glyma18g02210.3   sequence type=predicted peptide   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFIENFKVESPNVKYTETEIQSVYNYETTELVHENRNGTYQWIVKPKSVNYQFKTNTHVPKLGVMLVGWGGNNGSTLTGGVIANREGISWATKDKIQQANYFGSLTQASAIRVGSFQGEEIYAPFKSLLPMVNPDDIVFGGWDISNMNLADAMARAKVFDIDLQKQLRPYMESMVPLPGIYDPDFIAANQEERANNVIKGTKQEQVQQIIKDIKAFKEATKVDKVVVLWTANTERYSNLVVGLNDTMENLLAAVDRNEAEISPSTLYAIACVMENVPFINGSPQNTFVPGLIDLAIARNTLIGGDDFKSGQTKMKSVLVDFLVGAGIKPTSIVSYNHLGNNDGMNLSAPQTFRSKEISKSNVVDDMVNSNAILYEPGL*

>Glyma18g02210.4   sequence type=predicted peptide   gene model=Glyma18g02210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFIENFKVESPNVKYTETEIQSVYNYETTELVHENRNGTYQWIVKPKSVNYQFKTNTHVPKLGVMLVGWGGNNGSTLTGGVIANREGISWATKDKIQQANYFGSLTQASAIRVGSFQGEEIYAPFKSLLPMVNPDDIVFGGWDISNMNLADAMARAKVFDIDLQKQLRPYMESMVPLPGIYDPDFIAANQEERANNVIKGTKQEQVQQIIKDIKAFKEATKVDKVVVLWTANTERYSNLVVGLNDTMENLLAAVDRNEAEISPSTLYAIACVMENVPFINGSPQNTFVPGLIDLAIARNTLIGGDDFKSGQTKMKSVLVDFLVGAGIKPTSIVSYNHLGNNDGMNLSAPQTFRSKEISKSNVVDDMVNSNAILYEPGEHPDHVVVIKYVPYVGDSKRAMDEYTSEIFMGGKNTIVLHNTCEDSLLAAPIILDLVLLAELSTRIQFKAENEVCMHC*







USDA Logo
Iowa State University Logo