SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma12g05510

Feature Type:gene_model
Chromosome:Gm12
Start:3673129
stop:3677570
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G06110AT Annotation by Michelle Graham. TAIR10: SKP1/ASK-interacting protein 16 | chr1:1853237-1854938 REVERSE LENGTH=436 SoyBaseE_val: 0ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0019243GO-bp Annotation by Michelle Graham. GO Biological Process: methylglyoxal catabolic process to D-lactate SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0019005GO-cc Annotation by Michelle Graham. GO Cellular Compartment: SCF ubiquitin ligase complex SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG4408 KOG Putative Mg2+ and Co2+ transporter CorD JGI ISS
PTHR14289Panther F-BOX ONLY PROTEIN 3 JGI ISS
PTHR14289:SF10Panther SUBFAMILY NOT NAMED JGI ISS
PF04379PFAM Protein of unknown function (DUF525) JGI ISS
UniRef100_C6T901UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6T901_SOYBN SoyBaseE_val: 0ISS
UniRef100_G7JEW2UniRef Annotation by Michelle Graham. Most informative UniRef hit: F-box protein SKIP16 n=1 Tax=Medicago truncatula RepID=G7JEW2_MEDTR SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma12g05510 not represented in the dataset

Glyma12g05510 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma11g13500 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.12g051100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma12g05510.1   sequence type=CDS   gene model=Glyma12g05510   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGGTTGGAATCGGTGGGAGATTTAGCGATTAACGTGATTCTGAAAAAATTAGGAGCCCAAGACATTGCGAGAGTGGCGTGTGTGAGCAAAAGGTTCAGTTCTTCCGCTTCCGATGACACTCTTTGGATCAATCTCTGCTTCAATGAACTCGCTTTGACACAACCCCTCGATCATCTCGGAAACCCTCTCTCTTCCTTCAAGGAATGCTATCTAGCATGGAGAGGAGCTTTTGTTATGTACCCTTGGTCTCTTGTTAAGCGTGTAAAAAGGTGCTGGGATAGAATAAAAACCTGGTTGACCAATAATTTTCCTGAAGCGGAGGCCACTCTTTGTAAAGGTGCAACTGAAGCTGACATTCAGGAGTTGGAGAATGTATTAAAGGTGAAATTGCCTCTTCCTACAAGGATCCTTTATCGCTTTCACAATGGGCAAGAATTTGCAAAGGCAGATCCAGAAACTAGTACATTTGGCAGATCTTTGGGTCTAATTGGTGGCTACTCCTTCTATGGTCATTTGGTGAATGTTTATCTATTACCTATATGTCAGATAATCCTAGAAACTCAGCAAACTAGGCGTCGCTTGAGCTTTTTAAGAAGATCAAAGTATGTTCTTGTGGCTGCTTCATCCACATACAGTAGAAAGTTGTTTTTCCTCAACTGTACCAATGGTCAACTATATGTCGGGACCAGGTCTCCTCTTACCGAAAGAGACATAATCCCTTGTGTACCTCATGACCTGATTAGTTTACATCAGGAATTGAATAGTTCAGAGCAACAAGATGCCATGCTACTGTGGTTAGAAGAACATGGTCGCCGTTTAGAACACGGCTTTATCAAACTTCATGATGAAGGAAATGGCAAAAGCATTAATCTTTTCCCAGAAGAACCCCATATTTGTTCAACGGCTGTTACTAATGGTGTGAAGGTTCGCGCTTCTGCACTGGTTATCCCTGAGTTGATGGATCTTCAAGATGACCTTGGAGAGTACTTATTTGCTTATTCAATCCGCTTGTCCCTTGAACCTCAAGGATGCATTATTAATGGAATGTCCTTCAGCTCTTGCCAGCTCCATTGGAGGCACTGGATCATCCGTGCTAATGATATTGTTATATCTGATGTCAGTGGAAAAGCTGTTATAGGACAGTTTCCACTTTTGCGTCCGGGTGCTCAAGAATTTGTTTATCAGAGTTGCACGCCTCTACCAACACCATCAGGTTCTATTGAAGGTTCTTTTACATTTATACCCGGCAGATTGGCAGACCCAAAAGGAGACCCTTTTCTAGCTACAGTGGCTCGTTTCCCGCTCCAGCTGCCAGACTATATATTCTGA

>Glyma12g05510.1   sequence type=predicted peptide   gene model=Glyma12g05510   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGLESVGDLAINVILKKLGAQDIARVACVSKRFSSSASDDTLWINLCFNELALTQPLDHLGNPLSSFKECYLAWRGAFVMYPWSLVKRVKRCWDRIKTWLTNNFPEAEATLCKGATEADIQELENVLKVKLPLPTRILYRFHNGQEFAKADPETSTFGRSLGLIGGYSFYGHLVNVYLLPICQIILETQQTRRRLSFLRRSKYVLVAASSTYSRKLFFLNCTNGQLYVGTRSPLTERDIIPCVPHDLISLHQELNSSEQQDAMLLWLEEHGRRLEHGFIKLHDEGNGKSINLFPEEPHICSTAVTNGVKVRASALVIPELMDLQDDLGEYLFAYSIRLSLEPQGCIINGMSFSSCQLHWRHWIIRANDIVISDVSGKAVIGQFPLLRPGAQEFVYQSCTPLPTPSGSIEGSFTFIPGRLADPKGDPFLATVARFPLQLPDYIF*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo