Soybean cDNA library Gm-c1032


Clones from this library are available from
    Biogenetic Services
    801 32nd Ave.
    Brookings, SD 57006 USA
    phone: 800 423 4163
    email: info@biogeneticservices.com

To insure that credit is given to the laboratory and scientists donating this valuable resource to the scientific community, the information provided with the library must be maintained and included with any transfer of biological materials or data derived from the library.

Source of Library (Donor):
Dr. Paul Keim Phone:   520-523-1078       e-mail:   paul.keim@nau.edu
Virginia H. Coryell   520-523-1372    virginia.coryell@nau.edu
Department of Biology FAX: 520-523-7500    
Box 5640        
Northern Arizona University        
Flagstaff, AZ 86011        

Short Description of Library:
The mRNA was isolated from cotyledons of 8-day-old 'Williams' seedlings which were propagated on paper towels with distilled water for 3 days (etiolated), then greenhouse grown for 5 days in potting soil. The cotyledons were flash-frozen in liquid nitrogen.

Stratagene's cDNA Synthesis Kit (catalog number 200401) was used to synthesize the cDNA. First-strand synthesis was performed with 5-methyl dCTP, hence the ligated cDNA was hemimethylated. A modification of Stratagene's first-strand synthesis primer was used. An "anchor" nucleotide (V=A, C, or G) was added to the 3' end of the primer [GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAG(T)18V] to anchor the primer at the 5' end of the poly(A) tract. After second-strand synthesis, the cDNA ends were filled in with cloned Pfu DNA, ligated to EcoRI adapters and subsequently phosphorylated. The cDNA was then precipitated and redissolved in sterile, RNase-, DNase-free water. The XhoI site within the first-strand synthesis primer was then restricted by digestion with XhoI from Promega (40U/ul); all XhoI sites in the cDNA would be protected by their hemimethylated status. The cDNA constructs were size-fractionated with a 500 bp cutoff, using GibcoBRL Life Technologies' cDNA Size Fractionation column. The column eluent was precipitated, redissolved, and ligated into Stratagene's pBluescript" II XR Predigested vector (pBluescript II SK(+) vector that has been digested with EcoRI and XhoI, and phosphorylated by Stratagene). 100% of the white and 87.5% of the blue colonies appear to contain recombinant plasmids with cDNA inserts, based on size (n=28 and 8, respectively).

Genotype/Cultivar:
Williams

Vector:
pBluescript" II SK(+)

Other Information:
1040 ul of transformed DH10B cells, approximately 30,420 cfu, in SOB and 8% glycerol, have been submitted. More library is available for further transformations.
ligation efficiency [(white cfu/total cfu)x100] = 62.4%/td>
transformation efficiency = 2.32x107 cfu/ug total DNA (GibcoBRL ElectroMAX DH10B cells)
average insert sizes:
white colonies = 978 bp (range from 300 to 1800 bp), n=25
blue colonies = 894 bp (range from 0 to 1350 bp), n=8
overall average insert size = 871 bp

Expected vector sequence flanking 8-Day Degenerating Cotyledon cDNA clones available through Incyte Genomics, Inc. or contributing investigator.
Return to the Soybean cDNA Page
Return to the Soybean EST Home Page