Soybean cDNA library Gm-c1028


Clones from this library are available from
    Biogenetic Services
    801 32nd Ave.
    Brookings, SD 57006 USA
    phone: 800 423 4163
    email: info@biogeneticservices.com

To insure that credit is given to the laboratory and scientists donating this valuable resource to the scientific community, the information provided with the library must be maintained and included with any transfer of biological materials or data derived from the library.

Source of Library (Donor):
Dr. Paul Keim Phone:   520-523-1078       e-mail:   paul.keim@nau.edu
Virginia H. Coryell   520-523-1372    virginia.coryell@nau.edu
Department of Biology FAX: 520-523-7500    
Box 5640        
Northern Arizona University        
Flagstaff, AZ 86011        

Short Description of Library:
The mRNA was isolated from roots of Glycine max 'Supernod' plants generously donated by Dr. Gary Stacey. The seedlings were innoculated with Bradyrhizobium japonicus, strain USDA110 prior to harvest.

Stratagene's cDNA Synthesis Kit (catalog number 200401) was used to synthesize the cDNA. First-strand synthesis was performed with 5-methyl dCTP, hence the ligated cDNA was hemimethylated. A modification of Stratagene's first-strand synthesis primer was used. An "anchor" nucleotide (V=A, C, or G) was added to the 3' end of the primer [GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAG(T)18V] to anchor the primer at the 5' end of the poly(A) tract. After second-strand synthesis, the cDNA ends were filled in with cloned Pfu DNA polymerase, ligated to EcoRI adapters and subsequently phosphorylated. The XhoI site within the first-strand synthesis primer was then restricted by digestion with XhoI; all XhoI sites in the cDNA would be protected by their hemimethylated status. The cDNA constructs were size-fractionated with a 500 bp cutoff, using GibcoBRL Life Technologies' cDNA Size Fractionation column. The column eluent was then ligated into Stratagene's pBluescript" II XR Predigested vector (pBluescript II SK(+) that has been digested with EcoRI and XhoI, and phosphorylated by Stratagene). Both the white and blue colonies appear to contain recombinant plasmids with cDNA inserts, based on size (n=25).

Genotype/Cultivar:
Supernod

Vector:
pBluescript® II XR

Other Information:
575 ul of transformed DH10B, approximately 116,314 cfu, in SOB and 8% glycerol have been submitted.
ligation efficiency [(white cfu/total cfu)x100] = 67.1%
transformation efficiency = 8.03x107 cfu/ug total DNA (GibcoBRL ElectroMAX" DH10B cells)
average insert sizes:
white colonies = 1159 bp (range from 125 to 2800 bp), n=20
blue colonies = 710 bp (range from 350 to 1000 bp), n=5
overall insert average size = 1011 bp

Expected vector sequence flanking cDNA library clones
826    M13 Reverse primer                         T3 primer
5’ GGAAAC AGCTATGACC ATG 3’           5’ A ATTAACCCTC ACTAAAGGG 3’
5’ GGAAAC AGCTATGACC ATGATTACGC CAAGCGCGCA ATTAACCCTC ACTAAAGGGA
3’ CCTTTG TCGATACTGG TACTAATGCG GTTCGCGCGT TAATTGGGAG TGATTTCCCT

                                         SK primer
                               5’ CGCTCTAGA ACTAGTGGAT C 3’
ACAAAAGCTG GAGCTCCACC GCGGTGGCGG CCGCTCTAGA ACTAGTGGAT CCCCCGGGCT
TGTTTTCGAC CTCGAGGTGG CGCCACCGCC GGCGAGATCT TGATCACCTA GGGGGCCCGA

       EcoR I adapter           Xho I
  5’ AATTC GGCACGAG 3’      5’ CTC GAG 3’
GCAGGAATTC GGCACGAG--cDNA--(A)nCTC GAGGGGGGGC CCGGTACCCA
CGTCCTTAAG CCGTGCTC--cDNA--(T)nGAG CTCCCCCCCG GGCCATGGGT
      3’ G CCGTGCTC 5’       
       EcoR I adapter

ATTCGCCCTA TAGTGAGTCG TATTACGCGC GCTCACTGGC CGTCGTTTTA C 3’
TAAGCGGGAT ATCACTCAGC ATAATGCGCG CGAGTGACCG GCAGCAAAAT G 5’
 3’ CGGGAT ATCACTCAGC ATAATG 5’   3’ TGACCG GCAGCAAAAT G 5’
             T7 primer                M13 —20 primer   600

Return to the Soybean cDNA Page
Return to the Soybean EST Home Page