Soybean cDNA library Gm-c1020


Clones from this library are available from
    Biogenetic Services
    801 32nd Ave.
    Brookings, SD 57006 USA
    phone: 800 423 4163
    email: info@biogeneticservices.com

To insure that credit is given to the laboratory and scientists donating this valuable resource to the scientific community, the information provided with the library must be maintained and included with any transfer of biological materials or data derived from the library.

Source of Library (Donor):
Dr. Paul Keim Phone:   520-523-1078       e-mail:   paul.keim@nau.edu
Virginia H. Coryell   520-523-1372    virginia.coryell@nau.edu
Department of Biology FAX: 520-523-7500    
Box 5640        
Northern Arizona University        
Flagstaff, AZ 86011        

Short Description of Library:
The mRNA was isolated from nodules on the roots of 2.5-month-old Glycine max 'Williams' plants that were greenhouse grown. The seeds were planted in vermiculite in 1-gallon white pots and watered with tap water. After 4 days, the seeds sprouted and each pot was inoculated with 100 ml of a 1/20 solution of Bradyrhizobium japonicus, strain USDA110. The USDA110 was grown in Bergersen's medium (142 mg/L Na2HPO4, 80 mg/L MgSO4.7H2O, 1 mg/L thiamine-HCl, 0.1 mg/L biotin, 3 mg/L FeCl3.6H2O, 30 mg/L CaCl2, 1mg/L MnSO4.H2O, 0.3 mg/L H3BO3, 0.3 mg/L ZnSO4.7H2O, 0.025 mg/L Na2MoO4.2H2O, 0.025 mg/L CuSO4.5H2O, 0.025 mg/L CoCl2.6H2O, 435 mg/L glutamic acid, 10 g/L mannitol, and 500 mg/L yeast extract). Nine days after sprouting, the plants were again inoculated with a 1/20 solution of Bradyrhizobium japonicus, strain USDA110, grown in Bergersen's medium. For the first 14 days after sprouting, the plants were watered with _-strength solution of Herridge's medium supplemented with 1 mM KNO3 (full strength, with supplement, consists of 101.1 mg/L KNO3, 17 mg/L KH2PO4, 21.8 mg/L K2HPO4, 18.7 mg/L KCl, 123.3 mg/L MgSO4.7H2O, 27.7 mg/L CaCl2, 8.7 mg/L iron EDTA, 0.715 mg/L H3BO3, 0.453 mg/L MnCl2.4H2O, 0.028 mg/L ZnCl2, 0.013 mg/L CuCl2.2H2O, 0.006 mg/L Na2MoO4.2H2O). Beyond 14 days after sprouting, full-strength Herridge's medium supplemented with 1 mM KNO3 was used to water the plants. At 2.5 months, the plants were removed from the vermiculite, washed, and the nodules were removed and placed into liquid nitrogen.

Stratagene's cDNA Synthesis Kit (catalog number 200401) was used to synthesize the cDNA. First-strand synthesis was performed with 5-methyl dCTP, hence the ligated cDNA was hemimethylated. A modification of Stratagene's first-strand synthesis primer was used. An "anchor" nucleotide (V=A, C, or G) was added to the 3' end of the primer [GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAG(T)18V] to anchor the primer at the 5' end of the poly(A) tract. After second-strand synthesis, the cDNA ends were filled in with cloned Pfu DNA polymerase and size-fractionated with a 400 bp cutoff, using a SizeSep 400 Spun column from Pharmacia. The column eluent was ligated to EcoRI adapters and phosphorylated. The XhoI site within the first-strand synthesis primer was then restricted by digestion with XhoI; all XhoI sites in the cDNA would be protected by their hemimethylated status. The cDNA constructs were size-fractionated with a 500 bp cutoff, using GibcoBRL Life Technologies' cDNA Size Fractionation column. The column eluent was then ligated into Stratagene's pBluescript" II XR Predigested vector (pBluescript II SK(+) that has been digested with EcoRI and XhoI, and phosphorylated by Stratagene). Both the white and blue colonies appear to contain recombinant plasmids with cDNA inserts, based on size (n=56) and sequence (n=16).

Genotype/Cultivar:
Williams

Vector:
pBluescript® II XR

Other Information:
827 ul of transformed DH10B, approximately 94,749 cfu, in 1 LB and 25% glycerol, with an additional 25-ul aliquot (about 2,864 cfu) of the same, have been submitted. An additional 5 ul of library ligation (about 1.15x106 cfu) in a 3ng DNA/ul solution have also been submitted.
ligation efficiency [(white cfu/total cfu)x100] = 79.2%
transformation efficiency = 7.69x107 cfu/ug total DNA (GibcoBRL ElectroMAX" DH10B cells)
average insert sizes:
white colonies = 693 bp (range from 199 to 1500 bp), n=48
blue colonies = 507 bp (range from 150 to 1100 bp), n=8
overall insert average size = 654bp

Expected vector sequence flanking cDNA library clones
826    M13 Reverse primer                         T3 primer
5’ GGAAAC AGCTATGACC ATG 3’           5’ A ATTAACCCTC ACTAAAGGG 3’
5’ GGAAAC AGCTATGACC ATGATTACGC CAAGCGCGCA ATTAACCCTC ACTAAAGGGA
3’ CCTTTG TCGATACTGG TACTAATGCG GTTCGCGCGT TAATTGGGAG TGATTTCCCT

                                         SK primer
                               5’ CGCTCTAGA ACTAGTGGAT C 3’
ACAAAAGCTG GAGCTCCACC GCGGTGGCGG CCGCTCTAGA ACTAGTGGAT CCCCCGGGCT
TGTTTTCGAC CTCGAGGTGG CGCCACCGCC GGCGAGATCT TGATCACCTA GGGGGCCCGA

       EcoR I adapter           Xho I
  5’ AATTC GGCACGAG 3’      5’ CTC GAG 3’
GCAGGAATTC GGCACGAG--cDNA--(A)nCTC GAGGGGGGGC CCGGTACCCA
CGTCCTTAAG CCGTGCTC--cDNA--(T)nGAG CTCCCCCCCG GGCCATGGGT
      3’ G CCGTGCTC 5’       
       EcoR I adapter

ATTCGCCCTA TAGTGAGTCG TATTACGCGC GCTCACTGGC CGTCGTTTTA C 3’
TAAGCGGGAT ATCACTCAGC ATAATGCGCG CGAGTGACCG GCAGCAAAAT G 5’
 3’ CGGGAT ATCACTCAGC ATAATG 5’   3’ TGACCG GCAGCAAAAT G 5’
             T7 primer                M13 —20 primer   600

Return to the Soybean cDNA Page
Return to the Soybean EST Home Page