Soybean cDNA library Gm-c1004


Clones from this library are available from
    Biogenetic Services
    801 32nd Ave.
    Brookings, SD 57006 USA
    phone: 800 423 4163
    email: info@biogeneticservices.com

To insure that credit is given to the laboratory and scientists donating this valuable resource to the scientific community, the information provided with the library must be maintained and included with any transfer of biological materials or data derived from the library.

Source of Library (Donor):
Dr. Paul Keim Phone:   520-523-1078       e-mail:   paul.keim@nau.edu
Virginia H. Coryell   520-523-1372    virginia.coryell@nau.edu
Department of Biology FAX: 520-523-7500    
Box 5640        
Northern Arizona University        
Flagstaff, AZ 86011        

Short Description of Library:
The mRNA was isolated from entire roots of 8-day-old 'Williams' seedlings which were propagated on paper towels with distilled water. Stratagene's cDNA Synthesis Kit (catalog number 200401) was used to synthesize the cDNA. First-strand synthesis was performed with 5-methyl dCTP, hence the ligated cDNA is hemimethylated. Stratagene's first-strand synthesis primer was used [GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAG(T)18]. After second-strand synthesis, the cDNA ends were "polished" with cloned Pfu DNA polymerase, ligated to EcoRI adapters, and phosphorylated. The XhoI site within the first-strand synthesis primer was restricted by digestion with XhoI; all XhoI sites in the cDNA would be protected by their hemimethylated status. The cDNA constructs were size-fractionated with a 500 bp cutoff, using GibcoBRL Life Technologies' cDNA Size Fractionation column. The column eluent was then ligated into Stratagene's pBluescript® II XR predigested vector (pBluescript II SK(+) that had been digested with EcoRI and XhoI, and phosphorylated). Both the white and blue colonies appear to contain recombinant plasmids with cDNA inserts. Blue colonies (n=15) have been sequenced, and possess putative cDNA inserts. A complete vector and adapter sequence, from M13 Reverse primer to M13 20 primer, is shown below.

Genotype/Cultivar:
Williams

Vector:
pBluescript® II XR

Other Information:
1,880 ml of transformed DH10B ; approximately 49,256 cfu in 1X LB and 25% glycerol, with 2 additional 50-ml aliquots (about 1310 cfu each) of the same for preliminary picking/screening
ligation efficiency (white cfu/total cfu)x100 = 83%
transformation efficiency = 1.06 x 107 white cfu/mg vector DNA (GibcoBRL ElectroMAX® DH10B cells)
average insert sizes:white colonies = 844 bp (range from 150 to 2000 bp), n=79
blue colonies = 656 bp (range from 375 to 950 bp), n=18
overall insert average size = 812 bp

Expected vector sequence flanking cDNA library clones
826    M13 Reverse primer                         T3 primer
5’ GGAAAC AGCTATGACC ATG 3’           5’ A ATTAACCCTC ACTAAAGGG 3’
5’ GGAAAC AGCTATGACC ATGATTACGC CAAGCGCGCA ATTAACCCTC ACTAAAGGGA
3’ CCTTTG TCGATACTGG TACTAATGCG GTTCGCGCGT TAATTGGGAG TGATTTCCCT

                                         SK primer
                               5’ CGCTCTAGA ACTAGTGGAT C 3’
ACAAAAGCTG GAGCTCCACC GCGGTGGCGG CCGCTCTAGA ACTAGTGGAT CCCCCGGGCT
TGTTTTCGAC CTCGAGGTGG CGCCACCGCC GGCGAGATCT TGATCACCTA GGGGGCCCGA

       EcoR I adapter           Xho I
  5’ AATTC GGCACGAG 3’      5’ CTC GAG 3’
GCAGGAATTC GGCACGAG--cDNA--(A)nCTC GAGGGGGGGC CCGGTACCCA
CGTCCTTAAG CCGTGCTC--cDNA--(T)nGAG CTCCCCCCCG GGCCATGGGT
      3’ G CCGTGCTC 5’       
       EcoR I adapter

ATTCGCCCTA TAGTGAGTCG TATTACGCGC GCTCACTGGC CGTCGTTTTA C 3’
TAAGCGGGAT ATCACTCAGC ATAATGCGCG CGAGTGACCG GCAGCAAAAT G 5’
 3’ CGGGAT ATCACTCAGC ATAATG 5’   3’ TGACCG GCAGCAAAAT G 5’
             T7 primer                M13 —20 primer   600

Return to the Soybean cDNA Page
Return to the Soybean EST Home Page