Soybean cDNA library Gm-c1078


Clones from this library are available from
    Biogenetic Services
    801 32nd Ave.
    Brookings, SD 57006 USA
    phone: 800 423 4163
    email: info@biogeneticservices.com

To insure that credit is given to the laboratory and scientists donating this valuable resource to the scientific community, the information provided with the library must be maintained and included with any transfer of biological materials or data derived from the library.

Source of Library (Donor):
Dr. Paul Keim Phone:   520-523-1078       e-mail:   paul.keim@nau.edu
Virginia H. Coryell   520-523-1372    virginia.coryell@nau.edu
Department of Biology FAX: 520-523-7500    
Box 5640        
Northern Arizona University        
Flagstaff, AZ 86011        

Short Description of Library:
The mRNA was isolated from roots of 7-day-old 'Bragg' supernodulating mutant NTS382 seedlings that were infected with Bradyrhizobium japonimum, strain USDA 110, 48 hours prior to harvest. The roots were flash-frozen in liquid nitrogen.
Stratagene's cDNA Synthesis Kit (catalog number 200401) was used to synthesize the cDNA. First-strand synthesis was performed with 5-methyl dCTP, hence the ligated cDNA was hemimethylated. A modification of Stratagene's first-strand synthesis primer was used. An "anchor" nucleotide (V=A, C, or G) was added to the 3' end of the primer [GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAG(T)18V] to anchor the primer at the 5' end of the poly(A) tract. After second-strand synthesis, the cDNA ends were filled in with cloned Pfu DNA, ligated to EcoRI adapters and subsequently phosphorylated. The cDNA was then precipitated and redissolved in sterile, RNase-, DNase-free water. The XhoI site within the first-strand synthesis primer was then restricted by digestion with XhoI from Promega (40U/ul); all XhoI sites in the cDNA would be protected by their hemimethylated status. The cDNA constructs were size-fractionated with a 500 bp cutoff, using Sephacryl S-500 High Resolution (Pharmacia Biotech) in a 2-mm diameter column and a bed volume of approximately 1.3 mL. The column eluent was precipiated, redissolved, and ligated into Stratagene's pBluescript" II XR Predigested vector (pBluescript II SK(+) vector that has been digested with EcoRI and XhoI, and phosphorylated by Stratagene).

Genotype/Cultivar:
'Bragg' supernodulating mutant NTS382

Vector:
pBluescript" II SK(+)

Other Information:
~1200 ul of transformed DH10B cells, approximately 20,890 cfu, in SOB and 8% glycerol, have been submitted. More library is available for further transformations.
ligation efficiency [(white cfu/total cfu)x100] = 80.4%
average insert sizes:
white colonies = 723 bp (range from 400 to 1200 bp), n=11

Expected vector sequence flanking 48-hour Infected Supernod Root cDNA clones available through Genome Systems or contributing investigator.
Return to the Soybean cDNA Page
Return to the Soybean EST Home Page