The mRNA was isolated from cotyledons of 8-day-old 'Williams' seedlings which were propagated on paper towels with distilled water for 3 days (etiolated), then greenhouse grown for 5 days in potting soil. The cotyledons were flash-frozen in liquid nitrogen.
Stratagene's cDNA Synthesis Kit (catalog number 200401) was used to synthesize the cDNA. First-strand synthesis was performed with 5-methyl dCTP, hence the ligated cDNA was hemimethylated. A modification of Stratagene's first-strand synthesis primer was used. An "anchor" nucleotide (V=A, C, or G) was added to the 3' end of the primer [GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAG(T)18V] to anchor the primer at the 5' end of the poly(A) tract. After second-strand synthesis, the cDNA ends were filled in with cloned Pfu DNA, ligated to EcoRI adapters and subsequently phosphorylated. The cDNA was then precipitated and redissolved in sterile, RNase-, DNase-free water. The XhoI site within the first-strand synthesis primer was then restricted by digestion with XhoI from Promega (40U/ul); all XhoI sites in the cDNA would be protected by their hemimethylated status. The cDNA constructs were size-fractionated with a 500 bp cutoff, using GibcoBRL Life Technologies' cDNA Size Fractionation column. The column eluent was precipitated, redissolved, and ligated into Stratagene's pBluescript" II XR Predigested vector (pBluescript II SK(+) vector that has been digested with EcoRI and XhoI, and phosphorylated by Stratagene). 100% of the white and 87.5% of the blue colonies appear to contain recombinant plasmids with cDNA inserts, based on size (n=28 and 8, respectively). |