The mRNA was isolated from nodules on the roots of 2.5-month-old Glycine max 'Williams' plants that were greenhouse grown. The seeds were planted in vermiculite in 1-gallon white pots and watered with tap water. After 4 days, the seeds sprouted and each pot was inoculated with 100 ml of a 1/20 solution of Bradyrhizobium japonicus, strain USDA110. The USDA110 was grown in Bergersen's medium (142 mg/L Na2HPO4, 80 mg/L MgSO4.7H2O, 1 mg/L thiamine-HCl, 0.1 mg/L biotin, 3 mg/L FeCl3.6H2O, 30 mg/L CaCl2, 1mg/L MnSO4.H2O, 0.3 mg/L H3BO3, 0.3 mg/L ZnSO4.7H2O, 0.025 mg/L Na2MoO4.2H2O, 0.025 mg/L CuSO4.5H2O, 0.025 mg/L CoCl2.6H2O, 435 mg/L glutamic acid, 10 g/L mannitol, and 500 mg/L yeast extract). Nine days after sprouting, the plants were again inoculated with a 1/20 solution of Bradyrhizobium japonicus, strain USDA110, grown in Bergersen's medium. For the first 14 days after sprouting, the plants were watered with _-strength solution of Herridge's medium supplemented with 1 mM KNO3 (full strength, with supplement, consists of 101.1 mg/L KNO3, 17 mg/L KH2PO4, 21.8 mg/L K2HPO4, 18.7 mg/L KCl, 123.3 mg/L MgSO4.7H2O, 27.7 mg/L CaCl2, 8.7 mg/L iron EDTA, 0.715 mg/L H3BO3, 0.453 mg/L MnCl2.4H2O, 0.028 mg/L ZnCl2, 0.013 mg/L CuCl2.2H2O, 0.006 mg/L Na2MoO4.2H2O). Beyond 14 days after sprouting, full-strength Herridge's medium supplemented with 1 mM KNO3 was used to water the plants. At 2.5 months, the plants were removed from the vermiculite, washed, and the nodules were removed and placed into liquid nitrogen.
Stratagene's cDNA Synthesis Kit (catalog number 200401) was used to synthesize the cDNA. First-strand synthesis was performed with 5-methyl dCTP, hence the ligated cDNA was hemimethylated. A modification of Stratagene's first-strand synthesis primer was used. An "anchor" nucleotide (V=A, C, or G) was added to the 3' end of the primer [GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAG(T)18V] to anchor the primer at the 5' end of the poly(A) tract. After second-strand synthesis, the cDNA ends were filled in with cloned Pfu DNA polymerase and size-fractionated with a 400 bp cutoff, using a SizeSep 400 Spun column from Pharmacia. The column eluent was ligated to EcoRI adapters and phosphorylated. The XhoI site within the first-strand synthesis primer was then restricted by digestion with XhoI; all XhoI sites in the cDNA would be protected by their hemimethylated status. The cDNA constructs were size-fractionated with a 500 bp cutoff, using GibcoBRL Life Technologies' cDNA Size Fractionation column. The column eluent was then ligated into Stratagene's pBluescript" II XR Predigested vector (pBluescript II SK(+) that has been digested with EcoRI and XhoI, and phosphorylated by Stratagene). Both the white and blue colonies appear to contain recombinant plasmids with cDNA inserts, based on size (n=56) and sequence (n=16). |
