The mRNA was isolated from entire roots of 2-month-old 'Williams' plants that were greenhouse grown in 5-gallon pots. To suppress nodulation, Black Gold All-Purpose potting soil was supplemented with: 0.36g/L available phosphoric acid (P2O5), 20mg/L urea N, 0.16g/L S, 0.49mg/L B, 2.5mg/L Cu, 0.15g/L Fe, 13.53mg/L Mn, 0.26mg/L Mo, 14mg/L Zn, 20mg/L Ca, and the following nutrients in a slow-release form (Osmocote): 0.165g/L ammonia N, 0.185g/L nitrate N, 0.35g/L available phosphoric acid, and 0.35g/L soluble potash. No nodules were visible on the roots at harvest.
Stratagene's cDNA Synthesis Kit (catalog number 200401) was used to synthesize the cDNA. First-strand synthesis was performed with 5-methyl dCTP, hence the ligated cDNA was hemimethylated. Stratagene's first-strand synthesis primer was used [GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAG(T)18]. After second-strand synthesis, the cDNA ends were "polished" with cloned Pfu DNA polymerase, ligated to EcoRI adapters, and phosphorylated. The XhoI site within the first-strand synthesis primer was restricted by digestion with XhoI; all XhoI sites in the cDNA would be protected by their hemimethylated status. The cDNA constructs were size-fractionated with a 400 bp cutoff, using a SizeSep 400 Spun column from Pharmacia. The column eluent was then ligated into Stratagene's pBluescript® II XR predigested vector (pBluescript II SK(+) that had been digested with EcoRI and XhoI, and phosphorylated). Both the white and blue colonies appear to contain recombinant plasmids with cDNA inserts. A complete vector and adapter sequence, from M13 Reverse primer to M13 20 primer, is shown below.
|
